SZGR2

Summary ?

GeneID	655
Symbol	BMP7
Synonyms	OP-1
Description	bone morphogenetic protein 7
Reference	MIM:112267\|HGNC:HGNC:1074\|Ensembl:ENSG00000101144\|HPRD:00212\|Vega:OTTHUMG00000032812
Gene type	protein-coding
Map location	20q13
Pascal p-value	0.596
Fetal beta	0.281
DMG	2 (# studies)
eGene	Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	4
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	4
Expression	Meta-analysis of gene expression	P value: 1.368
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg23420286	20	55835350	BMP7	1.85E-4	0.65	0.034	DMG:Wockner_2014
cg15069906	20	55841888	BMP7	3.458E-4	-0.285	0.041	DMG:Wockner_2014
cg20292547	20	55841342	BMP7	4.364E-4	-0.2	0.045	DMG:Wockner_2014
cg00340850	20	55500523	BMP7	1.29E-10	-0.027	4.83E-7	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs6849842	chr4	185436254	BMP7	655		0.03		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
KIAA1219	0.95	0.97
TAOK1	0.94	0.96
BRAF	0.94	0.96
VCPIP1	0.94	0.96
ZYG11B	0.94	0.96
RLIM	0.93	0.96
DENND5B	0.93	0.96
NUFIP2	0.93	0.96
SEL1L	0.92	0.94
ZBTB44	0.92	0.94

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FXYD1	-0.66	-0.75
HIGD1B	-0.62	-0.74
TLCD1	-0.62	-0.70
C19orf36	-0.62	-0.67
S100A16	-0.61	-0.70
CST3	-0.60	-0.70
AC021016.1	-0.60	-0.68
MT-CO2	-0.60	-0.72
SERPINB6	-0.60	-0.66
ENHO	-0.60	-0.72

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005125	cytokine activity	IEA		-
GO:0005515	protein binding	IPI		12478285 \|12667445
GO:0008083	growth factor activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007411	axon guidance	IEA	axon (GO term level: 13)	-
GO:0001503	ossification	IEA		-
GO:0001707	mesoderm formation	IEA		-
GO:0001837	epithelial to mesenchymal transition	TAS		14679171
GO:0001822	kidney development	IEA		-
GO:0009887	organ morphogenesis	IEA		-
GO:0048468	cell development	IEA		-
GO:0007435	salivary gland morphogenesis	IEA		-
GO:0007389	pattern specification process	IEA		-
GO:0042475	odontogenesis of dentine-containing tooth	IEA		-
GO:0030501	positive regulation of bone mineralization	IDA		18436533
GO:0030509	BMP signaling pathway	IEA		-
GO:0051216	cartilage development	IEA		-
GO:0048754	branching morphogenesis of a tube	IEA		-
GO:0040007	growth	IEA		-
GO:0045941	positive regulation of transcription	IDA		14517293
GO:0045786	negative regulation of cell cycle	IDA		11502704
GO:0045669	positive regulation of osteoblast differentiation	IDA		18436533
GO:0048593	camera-type eye morphogenesis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005615	extracellular space	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACVR1	ACTRI \| ACVR1A \| ACVRLK2 \| ALK2 \| FOP \| SKR1 \| TSRI	activin A receptor, type I	-	HPRD,BioGRID	8006002
ACVR2A	ACTRII \| ACVR2	activin A receptor, type IIA	-	HPRD,BioGRID	9748228
ACVR2B	ACTRIIB \| ActR-IIB \| MGC116908	activin A receptor, type IIB	-	HPRD,BioGRID	9748228
BMP7	OP-1	bone morphogenetic protein 7	Co-purification	BioGRID	12478285
BMPR1A	10q23del \| ACVRLK3 \| ALK3 \| CD292	bone morphogenetic protein receptor, type IA	Reconstituted Complex	BioGRID	8006002
BMPR1A	10q23del \| ACVRLK3 \| ALK3 \| CD292	bone morphogenetic protein receptor, type IA	-	HPRD	7791754 \|8605097
BMPR1B	ALK-6 \| ALK6 \| CDw293	bone morphogenetic protein receptor, type IB	-	HPRD	8605097
BMPR1B	ALK-6 \| ALK6 \| CDw293	bone morphogenetic protein receptor, type IB	Reconstituted Complex	BioGRID	8006002
BMPR2	BMPR-II \| BMPR3 \| BMR2 \| BRK-3 \| FLJ41585 \| FLJ76945 \| PPH1 \| T-ALK	bone morphogenetic protein receptor, type II (serine/threonine kinase)	-	HPRD,BioGRID	7791754
ENG	CD105 \| END \| FLJ41744 \| HHT1 \| ORW \| ORW1	endoglin	-	HPRD,BioGRID	9872992
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	-	HPRD	7791754
NOG	SYM1 \| SYNS1	noggin	-	HPRD,BioGRID	12478285
SMAD1	BSP1 \| JV4-1 \| JV41 \| MADH1 \| MADR1	SMAD family member 1	Phenotypic Suppression	BioGRID	11438941
SOSTDC1	CDA019 \| DKFZp564D206 \| ECTODIN \| USAG1	sclerostin domain containing 1	-	HPRD,BioGRID	14623234 \|15020244

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION	267	161	All SZGR 2.0 genes in this pathway
KEGG HEDGEHOG SIGNALING PATHWAY	56	42	All SZGR 2.0 genes in this pathway
KEGG TGF BETA SIGNALING PATHWAY	86	64	All SZGR 2.0 genes in this pathway
BIOCARTA ALK PATHWAY	37	29	All SZGR 2.0 genes in this pathway
PID BMP PATHWAY	42	31	All SZGR 2.0 genes in this pathway
PID ALK2 PATHWAY	11	9	All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 DN	267	178	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN	493	298	All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP	184	125	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP	372	227	All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP	269	146	All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN	258	141	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL DN	118	79	All SZGR 2.0 genes in this pathway
HUMMEL BURKITTS LYMPHOMA UP	43	27	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS DN	136	94	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 DN	229	142	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN	193	112	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 2 DN	51	42	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM2	153	102	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM3	70	37	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
GOUYER TATI TARGETS DN	17	12	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS	179	105	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN	357	212	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 20Q12 Q13 AMPLICON	149	76	All SZGR 2.0 genes in this pathway
PENG LEUCINE DEPRIVATION UP	142	93	All SZGR 2.0 genes in this pathway
BASSO CD40 SIGNALING DN	68	44	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD DN	150	93	All SZGR 2.0 genes in this pathway
NIELSEN GIST VS SYNOVIAL SARCOMA UP	19	12	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY DN	145	88	All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP	262	186	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP	268	157	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN	161	105	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5	482	296	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P2	79	55	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P6	91	44	All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS	217	138	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC	210	123	All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC	58	43	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS DN	105	63	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN	270	181	All SZGR 2.0 genes in this pathway
FUJII YBX1 TARGETS DN	202	132	All SZGR 2.0 genes in this pathway
CHENG IMPRINTED BY ESTRADIOL	110	68	All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6	469	239	All SZGR 2.0 genes in this pathway
ENGELMANN CANCER PROGENITORS DN	70	44	All SZGR 2.0 genes in this pathway
MCCABE HOXC6 TARGETS UP	10	8	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP	149	85	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
GYORFFY DOXORUBICIN RESISTANCE	56	34	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS	535	325	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
NIELSEN LEIOMYOSARCOMA CNN1 DN	20	18	All SZGR 2.0 genes in this pathway
BAE BRCA1 TARGETS UP	75	47	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP	134	85	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7	403	240	All SZGR 2.0 genes in this pathway
MALIK REPRESSED BY ESTROGEN	12	10	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS	344	197	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-542-3p	438	444	1A	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BMP7