Gene Page: SLC25A1
Summary ?
| GeneID | 6576 |
| Symbol | SLC25A1 |
| Synonyms | CTP|D2L2AD|SEA|SLC20A3 |
| Description | solute carrier family 25 member 1 |
| Reference | MIM:190315|HGNC:HGNC:10979|Ensembl:ENSG00000100075|HPRD:01832|Vega:OTTHUMG00000150123 |
| Gene type | protein-coding |
| Map location | 22q11.21 |
| Pascal p-value | 0.056 |
| Sherlock p-value | 0.637 |
| TADA p-value | 0.009 |
| Fetal beta | 0.549 |
| eGene | Anterior cingulate cortex BA24 Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Hippocampus Myers' cis & trans |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_mitochondria |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Gulsuner_2013 | Whole Exome Sequencing analysis | 155 DNMs identified by exome sequencing of quads or trios of schizophrenia individuals and their parents. | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| SLC25A1 | chr22 | 19163726 | G | A | NM_001256534 NM_005984 NR_033687 NR_046298 | p.292R>W p.285R>W . . | missense missense npcRNA npcRNA | Schizophrenia | DNM:Gulsuner_2013 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs10126993 | chrX | 35885796 | SLC25A1 | 6576 | 0.07 | trans | ||
| rs4501739 | chrX | 35960848 | SLC25A1 | 6576 | 3.682E-4 | trans | ||
| rs712959 | 22 | 19159015 | SLC25A1 | ENSG00000100075.5 | 9.60791E-7 | 0.03 | 7328 | gtex_brain_ba24 |
| rs698422 | 22 | 19205826 | SLC25A1 | ENSG00000100075.5 | 7.93346E-7 | 0.03 | -39483 | gtex_brain_ba24 |
| rs1206544 | 22 | 19215039 | SLC25A1 | ENSG00000100075.5 | 1.13711E-6 | 0.03 | -48696 | gtex_brain_ba24 |
| rs809901 | 22 | 19228736 | SLC25A1 | ENSG00000100075.5 | 8.42041E-7 | 0.03 | -62393 | gtex_brain_ba24 |
| rs807431 | 22 | 19242361 | SLC25A1 | ENSG00000100075.5 | 8.4382E-7 | 0.03 | -76018 | gtex_brain_ba24 |
| rs9605972 | 22 | 19253274 | SLC25A1 | ENSG00000100075.5 | 7.89123E-7 | 0.03 | -86931 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| VSNL1 | 0.94 | 0.92 |
| ZNF365 | 0.93 | 0.84 |
| HLF | 0.91 | 0.80 |
| AGBL4 | 0.90 | 0.88 |
| NSF | 0.90 | 0.92 |
| EHD3 | 0.90 | 0.86 |
| CHN1 | 0.90 | 0.83 |
| GABRA1 | 0.90 | 0.85 |
| GABARAPL3 | 0.90 | 0.92 |
| CAMK2A | 0.90 | 0.80 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| BCL7C | -0.59 | -0.64 |
| FADS2 | -0.55 | -0.43 |
| SH3BP2 | -0.51 | -0.53 |
| TRAF4 | -0.50 | -0.48 |
| AC006276.2 | -0.50 | -0.44 |
| SH2B2 | -0.49 | -0.50 |
| SEMA4B | -0.49 | -0.41 |
| PDE9A | -0.49 | -0.43 |
| NME4 | -0.49 | -0.55 |
| CDC42EP4 | -0.48 | -0.48 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 17353931 | |
| GO:0005215 | transporter activity | IEA | - | |
| GO:0015137 | citrate transmembrane transporter activity | TAS | 8666394 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006810 | transport | IEA | - | |
| GO:0006843 | mitochondrial citrate transport | TAS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005739 | mitochondrion | IEA | - | |
| GO:0005743 | mitochondrial inner membrane | TAS | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME TRIGLYCERIDE BIOSYNTHESIS | 38 | 26 | All SZGR 2.0 genes in this pathway |
| REACTOME FATTY ACYL COA BIOSYNTHESIS | 18 | 15 | All SZGR 2.0 genes in this pathway |
| REACTOME GLUCONEOGENESIS | 34 | 21 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
| REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM | 168 | 115 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF CARBOHYDRATES | 247 | 154 | All SZGR 2.0 genes in this pathway |
| REACTOME GLUCOSE METABOLISM | 69 | 42 | All SZGR 2.0 genes in this pathway |
| FRASOR TAMOXIFEN RESPONSE UP | 51 | 36 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
| BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| STARK HYPPOCAMPUS 22Q11 DELETION DN | 20 | 19 | All SZGR 2.0 genes in this pathway |
| LE EGR2 TARGETS DN | 108 | 84 | All SZGR 2.0 genes in this pathway |
| ROSS ACUTE MYELOID LEUKEMIA CBF | 82 | 57 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
| ROSS AML WITH AML1 ETO FUSION | 76 | 55 | All SZGR 2.0 genes in this pathway |
| LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
| YAGI AML FAB MARKERS | 191 | 131 | All SZGR 2.0 genes in this pathway |
| REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
| BRACHAT RESPONSE TO METHOTREXATE DN | 27 | 19 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| KEEN RESPONSE TO ROSIGLITAZONE DN | 106 | 68 | All SZGR 2.0 genes in this pathway |
| BRACHAT RESPONSE TO CAMPTOTHECIN DN | 46 | 31 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS 6 | 189 | 112 | All SZGR 2.0 genes in this pathway |
| WONG MITOCHONDRIA GENE MODULE | 217 | 122 | All SZGR 2.0 genes in this pathway |
| ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN | 354 | 216 | All SZGR 2.0 genes in this pathway |
| MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
| MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
| VALK AML CLUSTER 13 | 30 | 20 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 UP | 140 | 94 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 410 | 416 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| miR-10 | 485 | 491 | m8 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
| hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
| miR-124.1 | 449 | 455 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 349 | 355 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-182 | 82 | 88 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-331 | 414 | 420 | m8 | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
| miR-96 | 81 | 88 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.