SZGR2

Summary ?

GeneID	6595
Symbol	SMARCA2
Synonyms	BAF190\|BRM\|NCBRS\|SNF2\|SNF2L2\|SNF2LA\|SWI2\|Sth1p\|hBRM\|hSNF2a
Description	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Reference	MIM:600014\|HGNC:HGNC:11098\|Ensembl:ENSG00000080503\|HPRD:02483\|Vega:OTTHUMG00000019445
Gene type	protein-coding
Map location	9p22.3
Pascal p-value	0.104
Sherlock p-value	0.139
Fetal beta	-0.744
DMG	1 (# studies)
eGene	Myers' cis & trans Meta
Support	CompositeSet Darnell FMRP targets Chromatin Remodeling Genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg01487461	9	2017199	SMARCA2	1.45E-9	-0.014	1.39E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs2785727	chr9	1577504	SMARCA2	6595		0.13		cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RPL30	0.94	0.84
RPL23	0.93	0.87
RPS8	0.93	0.88
HAUS1	0.93	0.88
RPL6P10	0.93	0.89
RPL35A	0.93	0.85
TUT1	0.92	0.87
RPS16P1	0.92	0.81
RPL5	0.91	0.90
RPS25P8	0.91	0.84

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
HLA-F	-0.59	-0.72
ATP10A	-0.59	-0.74
PTH1R	-0.58	-0.71
TINAGL1	-0.58	-0.76
FBXO2	-0.57	-0.66
AIFM3	-0.57	-0.72
ALDOC	-0.57	-0.69
TNFSF12	-0.56	-0.61
AF347015.27	-0.56	-0.78
SLC6A12	-0.56	-0.73

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003677	DNA binding	IEA		-
GO:0003713	transcription coactivator activity	TAS		8223438
GO:0005515	protein binding	IEA		-
GO:0005515	protein binding	IPI		8895581 \|12200431 \|12437990 \|14701856 \|15696166 \|16341228
GO:0005524	ATP binding	IEA		-
GO:0004386	helicase activity	TAS		8223438
GO:0016787	hydrolase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006357	regulation of transcription from RNA polymerase II promoter	TAS		8223438
GO:0006350	transcription	IEA		-
GO:0008285	negative regulation of cell proliferation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005654	nucleoplasm	TAS		8670841

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTL6A	ACTL6 \| Arp4 \| BAF53A \| INO80K \| MGC5382	actin-like 6A	-	HPRD,BioGRID	12437990
ACTL6B	ACTL6 \| BAF53B	actin-like 6B	-	HPRD,BioGRID	12437990
ARID1A	B120 \| BAF250 \| BAF250a \| BM029 \| C1orf4 \| P270 \| SMARCF1	AT rich interactive domain 1A (SWI-like)	Co-purification	BioGRID	8895581
ARID1B	6A3-5 \| BAF250b \| BRIGHT \| DAN15 \| ELD/OSA1 \| KIAA1235 \| p250R	AT rich interactive domain 1B (SWI1-like)	-	HPRD,BioGRID	12200431
BAZ1B	WBSCR10 \| WBSCR9 \| WSTF	bromodomain adjacent to zinc finger domain, 1B	-	HPRD	12837248
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	Affinity Capture-Western	BioGRID	15034933
CCNE1	CCNE	cyclin E1	Affinity Capture-Western	BioGRID	9891079
CDK8	K35 \| MGC126074 \| MGC126075	cyclin-dependent kinase 8	Co-fractionation	BioGRID	9710619
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	Affinity Capture-Western Reconstituted Complex	BioGRID	10619021
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	-	HPRD,BioGRID	9099865
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	Co-purification	BioGRID	11238380
HDAC2	RPD3 \| YAF1	histone deacetylase 2	Co-purification	BioGRID	11238380
MECP2	AUTSX3 \| DKFZp686A24160 \| MRX16 \| MRX79 \| MRXS13 \| MRXSL \| PPMX \| RTS \| RTT	methyl CpG binding protein 2 (Rett syndrome)	MeCP2 interacts with Brm.	BIND	15696166
MYB	Cmyb \| c-myb \| c-myb_CDS \| efg	v-myb myeloblastosis viral oncogene homolog (avian)	Reconstituted Complex	BioGRID	10619021
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	-	HPRD,BioGRID	8223438
PHB	PHB1	prohibitin	Prohibitin interacts with Brm.	BIND	12065415
PHB	PHB1	prohibitin	-	HPRD,BioGRID	12065415
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	-	HPRD,BioGRID	9710619
RBBP4	NURF55 \| RBAP48	retinoblastoma binding protein 4	Co-purification	BioGRID	11238380
RUVBL1	ECP54 \| INO80H \| NMP238 \| PONTIN \| Pontin52 \| RVB1 \| TIH1 \| TIP49 \| TIP49A	RuvB-like 1 (E. coli)	Co-fractionation	BioGRID	11839798
SIN3A	DKFZp434K2235 \| FLJ90319 \| KIAA0700	SIN3 homolog A, transcription regulator (yeast)	Co-purification Reconstituted Complex	BioGRID	11238380
SMARCB1	BAF47 \| INI1 \| RDT \| SNF5 \| SNF5L1 \| Sfh1p \| Snr1 \| hSNFS	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	Co-purification	BioGRID	8895581 \|11238380
SMARCC1	BAF155 \| CRACC1 \| Rsc8 \| SRG3 \| SWI3	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	Co-purification	BioGRID	8895581 \|11238380
SMARCC2	BAF170 \| CRACC2 \| Rsc8	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	Co-purification	BioGRID	8895581
SMARCE1	BAF57	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	Co-purification	BioGRID	8895581
SS18	MGC116875 \| SSXT \| SYT \| SYT-SSX1 \| SYT-SSX2	synovial sarcoma translocation, chromosome 18	-	HPRD,BioGRID	10072425 \|11734557 \|14603256

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID E2F PATHWAY	74	48	All SZGR 2.0 genes in this pathway
PID AR TF PATHWAY	53	38	All SZGR 2.0 genes in this pathway
PID CMYB PATHWAY	84	61	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
PYEON HPV POSITIVE TUMORS UP	98	47	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
SOTIRIOU BREAST CANCER GRADE 1 VS 3 DN	52	34	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN	384	230	All SZGR 2.0 genes in this pathway
RODRIGUES DCC TARGETS DN	121	84	All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN	258	141	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER DN	406	230	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE DN	54	38	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN	284	156	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
SCIBETTA KDM5B TARGETS DN	81	55	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP	316	190	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES CD4 DN	116	71	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN	394	258	All SZGR 2.0 genes in this pathway
TAKADA GASTRIC CANCER COPY NUMBER DN	29	15	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER WITH LOH IN CHR9Q	116	71	All SZGR 2.0 genes in this pathway
LI CISPLATIN RESISTANCE UP	28	20	All SZGR 2.0 genes in this pathway
KORKOLA YOLK SAC TUMOR	62	33	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX1 UP	15	10	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX4 DN	32	22	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
LU IL4 SIGNALING	94	56	All SZGR 2.0 genes in this pathway
SASAKI ADULT T CELL LEUKEMIA	176	122	All SZGR 2.0 genes in this pathway
HADDAD T LYMPHOCYTE AND NK PROGENITOR UP	78	56	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND DN	225	163	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS UP	56	35	All SZGR 2.0 genes in this pathway
MCCLUNG COCAINE REWARD 5D	79	62	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL	254	164	All SZGR 2.0 genes in this pathway
MEDINA SMARCA4 TARGETS	44	29	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 11	57	40	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1	419	273	All SZGR 2.0 genes in this pathway
LEIN NEURON MARKERS	69	45	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN	238	145	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2	356	214	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G3 DN	51	32	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S3	266	180	All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP	166	105	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS DN	207	139	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR DN	244	157	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	595	601	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-128	463	469	m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	463	469	m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-144	595	601	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-19	772	779	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	772	779	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-320	123	129	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-376	549	555	m8	hsa-miR-376a	AUCAUAGAGGAAAAUCCACGU
miR-376	549	555	m8	hsa-miR-376b	AUCAUAGAGGAAAAUCCAUGUU
miR-421	806	812	1A	hsa-miR-421	GGCCUCAUUAAAUGUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SMARCA2