SZGR2

Summary ?

GeneID	6645
Symbol	SNTB2
Synonyms	D16S2531E\|EST25263\|SNT2B2\|SNT3\|SNTL
Description	syntrophin beta 2
Reference	MIM:600027\|HGNC:HGNC:11169\|Ensembl:ENSG00000168807\|HPRD:02491\|Vega:OTTHUMG00000137567
Gene type	protein-coding
Map location	16q22.1
Pascal p-value	0.002
Sherlock p-value	0.71
Fetal beta	-0.369
DMG	1 (# studies)
eGene	Cerebellum
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:vanEijk_2014	Genome-wide DNA methylation analysis	This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250).	3
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.2389

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	Study
cg04779191	16	69166964	SNTB2	0.002	4.041	DMG:vanEijk_2014
cg12265604	16	69139568	SNTB2	0.001	3.903	DMG:vanEijk_2014
cg22067472	16	69458746	SNTB2	9.347E-4	3.055	DMG:vanEijk_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003779	actin binding	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005516	calmodulin binding	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0045202	synapse	IEA	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0005856	cytoskeleton	IEA		-
GO:0005874	microtubule	IEA		-
GO:0005624	membrane fraction	TAS		8576247
GO:0005737	cytoplasm	IEA		-
GO:0016020	membrane	IEA		-
GO:0016010	dystrophin-associated glycoprotein complex	TAS		8576247
GO:0030054	cell junction	IEA		-
GO:0031410	cytoplasmic vesicle	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABCA1	ABC-1 \| ABC1 \| CERP \| FLJ14958 \| HDLDT1 \| MGC164864 \| MGC165011 \| TGD	ATP-binding cassette, sub-family A (ABC1), member 1	-	HPRD,BioGRID	12054535
DGKZ	DAGK5 \| DAGK6 \| DGK-ZETA \| hDGKzeta	diacylglycerol kinase, zeta 104kDa	-	HPRD,BioGRID	11352924
DMD	BMD \| CMD3B \| DXS142 \| DXS164 \| DXS206 \| DXS230 \| DXS239 \| DXS268 \| DXS269 \| DXS270 \| DXS272	dystrophin	Protein-peptide	BioGRID	8576247
DTNA	D18S892E \| DRP3 \| DTN \| FLJ96209 \| LVNC1	dystrobrevin, alpha	-	HPRD	12206805
ERBB4	HER4 \| MGC138404 \| p180erbB4	v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)	-	HPRD,BioGRID	10725395
ERBB4	HER4 \| MGC138404 \| p180erbB4	v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)	ErbB-4 interacts with beta 2-syntropin.	BIND	10725395
KCNJ12	FLJ14167 \| IRK2 \| KCNJN1 \| Kir2.2 \| Kir2.2v \| hIRK \| hIRK1 \| hkir2.2x \| kcnj12x	potassium inwardly-rectifying channel, subfamily J, member 12	-	HPRD,BioGRID	15024025
MAST1	KIAA0973 \| SAST \| SAST170	microtubule associated serine/threonine kinase 1	-	HPRD,BioGRID	10404183
MAST2	FLJ39200 \| KIAA0807 \| MAST205 \| MTSSK \| RP4-533D7.1	microtubule associated serine/threonine kinase 2	-	HPRD,BioGRID	10404183
PTPRN	FLJ16131 \| IA-2 \| IA-2/PTP \| IA2 \| ICA512 \| R-PTP-N	protein tyrosine phosphatase, receptor type, N	-	HPRD,BioGRID	11483505
SCN5A	CDCD2 \| CMD1E \| CMPD2 \| HB1 \| HB2 \| HBBD \| HH1 \| ICCD \| IVF \| LQT3 \| Nav1.5 \| PFHB1 \| SSS1	sodium channel, voltage-gated, type V, alpha subunit	Affinity Capture-Western	BioGRID	9412493
UTRN	DMDL \| DRP \| DRP1 \| FLJ23678	utrophin	-	HPRD,BioGRID	8576247\|10995443

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN	391	222	All SZGR 2.0 genes in this pathway
TURASHVILI BREAST LOBULAR CARCINOMA VS DUCTAL NORMAL DN	91	53	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN	459	276	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN	226	132	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS UP	194	112	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN	137	97	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP	197	135	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP	169	127	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP	134	93	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR	293	193	All SZGR 2.0 genes in this pathway
VERNELL RETINOBLASTOMA PATHWAY UP	70	47	All SZGR 2.0 genes in this pathway
SARTIPY BLUNTED BY INSULIN RESISTANCE UP	19	17	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS	245	148	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
AMBROSINI FLAVOPIRIDOL TREATMENT TP53	109	63	All SZGR 2.0 genes in this pathway
STAMBOLSKY RESPONSE TO VITAMIN D3 UP	84	48	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 DN	88	61	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 DN	82	51	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
DELACROIX RAR TARGETS DN	24	16	All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES	462	273	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4	227	149	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	853	859	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-135	825	831	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	825	831	m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-138	7271	7277	1A	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-149	777	783	m8	hsa-miR-149^brain	UCUGGCUCCGUGUCUUCACUCC
miR-15/16/195/424/497	4295	4302	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-17-5p/20/93.mr/106/519.d	3474	3480	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-218	64	71	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-331	780	787	1A,m8	hsa-miR-331^brain	GCCCCUGGGCCUAUCCUAGAA
miR-410	8062	8068	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-503	4296	4302	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SNTB2