Gene Page: BNIP3L
Summary ?
GeneID | 665 |
Symbol | BNIP3L |
Synonyms | BNIP3a|NIX |
Description | BCL2/adenovirus E1B 19kDa interacting protein 3-like |
Reference | MIM:605368|HGNC:HGNC:1085|Ensembl:ENSG00000104765|HPRD:07288|Vega:OTTHUMG00000099433 |
Gene type | protein-coding |
Map location | 8p21 |
Pascal p-value | 3.064E-4 |
Sherlock p-value | 0.909 |
Fetal beta | 0.093 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg02464098 | 8 | 26240309 | BNIP3L | 4.22E-5 | -0.324 | 0.021 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs17014160 | chr1 | 206855799 | BNIP3L | 665 | 0.03 | trans | ||
rs16849258 | chr3 | 165317775 | BNIP3L | 665 | 0.05 | trans | ||
rs1199915 | 0 | BNIP3L | 665 | 0.1 | trans | |||
rs520325 | chr3 | 165361016 | BNIP3L | 665 | 0.12 | trans | ||
rs830202 | chr3 | 165654796 | BNIP3L | 665 | 0.01 | trans | ||
rs11953760 | chr5 | 9842943 | BNIP3L | 665 | 0.01 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C22orf28 | 0.87 | 0.87 |
C18orf10 | 0.86 | 0.85 |
VPS45 | 0.86 | 0.86 |
WRB | 0.86 | 0.86 |
C6orf62 | 0.86 | 0.85 |
RAN | 0.86 | 0.85 |
SMU1 | 0.86 | 0.84 |
RPN1 | 0.85 | 0.84 |
FAF1 | 0.85 | 0.85 |
SEC22A | 0.85 | 0.84 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.71 | -0.70 |
AF347015.8 | -0.70 | -0.70 |
AF347015.21 | -0.69 | -0.68 |
AF347015.33 | -0.68 | -0.69 |
AF347015.31 | -0.68 | -0.68 |
MT-CYB | -0.68 | -0.68 |
AF347015.2 | -0.67 | -0.69 |
AF347015.27 | -0.67 | -0.68 |
FXYD1 | -0.66 | -0.71 |
IFI27 | -0.66 | -0.72 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005521 | lamin binding | IDA | 10381623 | |
GO:0042803 | protein homodimerization activity | IDA | 10381623 | |
GO:0046982 | protein heterodimerization activity | IDA | 10381623 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006917 | induction of apoptosis | IDA | 9973195 | |
GO:0008634 | negative regulation of survival gene product expression | IDA | 9973195 | |
GO:0043065 | positive regulation of apoptosis | IEA | - | |
GO:0043066 | negative regulation of apoptosis | IDA | 10381623 | |
GO:0051607 | defense response to virus | IDA | 9973195 | |
GO:0044419 | interspecies interaction between organisms | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005635 | nuclear envelope | IDA | 10381623 | |
GO:0005739 | mitochondrion | IDA | 9973195 |10381623 | |
GO:0005740 | mitochondrial envelope | IEA | - | |
GO:0005783 | endoplasmic reticulum | IDA | 10381623 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID P53 DOWNSTREAM PATHWAY | 137 | 94 | All SZGR 2.0 genes in this pathway |
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT EARLY UP | 21 | 19 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
LIU CMYB TARGETS UP | 165 | 106 | All SZGR 2.0 genes in this pathway |
LIU VMYB TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
LAIHO COLORECTAL CANCER SERRATED UP | 112 | 71 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP | 119 | 66 | All SZGR 2.0 genes in this pathway |
BILBAN B CLL LPL UP | 63 | 39 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP | 185 | 126 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA UP | 171 | 112 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA BY DMOG UP | 130 | 85 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A TARGETS DN | 91 | 58 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A AND HIF2A TARGETS DN | 104 | 72 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF UP | 215 | 137 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
KAN RESPONSE TO ARSENIC TRIOXIDE | 123 | 80 | All SZGR 2.0 genes in this pathway |
LUI THYROID CANCER CLUSTER 2 | 42 | 31 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER UP | 227 | 137 | All SZGR 2.0 genes in this pathway |
ALCALA APOPTOSIS | 88 | 60 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
ROPERO HDAC2 TARGETS | 114 | 71 | All SZGR 2.0 genes in this pathway |
SUNG METASTASIS STROMA UP | 110 | 70 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION UP | 142 | 93 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
CHEOK RESPONSE TO HD MTX DN | 24 | 18 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION L1 G1 UP | 25 | 15 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE UP | 203 | 130 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 AND CD2 UP | 89 | 51 | All SZGR 2.0 genes in this pathway |
MENSE HYPOXIA UP | 98 | 71 | All SZGR 2.0 genes in this pathway |
MA MYELOID DIFFERENTIATION UP | 39 | 29 | All SZGR 2.0 genes in this pathway |
KIM HYPOXIA | 25 | 21 | All SZGR 2.0 genes in this pathway |
BRACHAT RESPONSE TO METHOTREXATE DN | 27 | 19 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS MATURE CELL | 293 | 160 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
HARRIS HYPOXIA | 81 | 64 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR DN | 148 | 102 | All SZGR 2.0 genes in this pathway |
BRACHAT RESPONSE TO CAMPTOTHECIN DN | 46 | 31 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE DN | 373 | 196 | All SZGR 2.0 genes in this pathway |
KYNG ENVIRONMENTAL STRESS RESPONSE NOT BY GAMMA IN WS | 33 | 22 | All SZGR 2.0 genes in this pathway |
KYNG ENVIRONMENTAL STRESS RESPONSE NOT BY UV IN OLD | 25 | 18 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE DN | 195 | 135 | All SZGR 2.0 genes in this pathway |
KYNG ENVIRONMENTAL STRESS RESPONSE UP | 56 | 41 | All SZGR 2.0 genes in this pathway |
SARRIO EPITHELIAL MESENCHYMAL TRANSITION DN | 154 | 101 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
WINTER HYPOXIA METAGENE | 242 | 168 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS DN | 210 | 128 | All SZGR 2.0 genes in this pathway |
MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
RUIZ TNC TARGETS UP | 153 | 107 | All SZGR 2.0 genes in this pathway |
JISON SICKLE CELL DISEASE UP | 181 | 106 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS UP | 91 | 59 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN UP | 90 | 58 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
VANDESLUIS COMMD1 TARGETS GROUP 3 UP | 89 | 50 | All SZGR 2.0 genes in this pathway |
FARDIN HYPOXIA 11 | 32 | 29 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-133 | 1290 | 1296 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-138 | 276 | 283 | 1A,m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
miR-183 | 2690 | 2696 | m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-23 | 842 | 848 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC | ||||
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-27 | 34 | 40 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-30-5p | 2651 | 2657 | 1A | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG | ||||
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-320 | 2339 | 2345 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA | ||||
miR-323 | 1276 | 1282 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-374 | 285 | 291 | 1A | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-544 | 1531 | 1538 | 1A,m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.