SZGR2

Summary ?

GeneID	6657
Symbol	SOX2
Synonyms	ANOP3\|MCOPS3
Description	SRY-box 2
Reference	MIM:184429\|HGNC:HGNC:11195\|Ensembl:ENSG00000181449\|HPRD:08921\|Vega:OTTHUMG00000158222
Gene type	protein-coding
Map location	3q26.33
Pascal p-value	0.082
Fetal beta	0.061

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression	Meta-analysis of gene expression	P value: 1.374
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ENO1	0.75	0.73
HIBADH	0.73	0.74
CD59	0.73	0.75
BTN3A3	0.73	0.71
CTSF	0.72	0.74
TECR	0.71	0.76
ATPAF1	0.71	0.75
NR1H2	0.71	0.79
SDHD	0.70	0.72
ANXA7	0.70	0.73

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ANKRD12	-0.45	-0.46
RTF1	-0.45	-0.45
CCAR1	-0.44	-0.49
AC004017.1	-0.44	-0.38
FNBP1L	-0.44	-0.35
ZNF551	-0.44	-0.38
PHF14	-0.44	-0.46
RBMX2	-0.43	-0.48
KIAA1949	-0.43	-0.35
AC109829.1	-0.43	-0.47

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	NAS		7849401
GO:0005515	protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001708	cell fate specification	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	NAS		7849401
GO:0006350	transcription	IEA		-
GO:0006325	establishment or maintenance of chromatin architecture	NAS		7849401
GO:0050973	detection of mechanical stimulus involved in equilibrioception	IEA		-
GO:0042472	inner ear morphogenesis	IEA		-
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IEA		-
GO:0050910	detection of mechanical stimulus involved in sensory perception of sound	IEA		-
GO:0046148	pigment biosynthetic process	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	NAS		7849401
GO:0005737	cytoplasm	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
VECCHI GASTRIC CANCER EARLY DN	367	220	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN	260	143	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING DN	58	35	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
LIU CDX2 TARGETS DN	8	5	All SZGR 2.0 genes in this pathway
KAN RESPONSE TO ARSENIC TRIOXIDE	123	80	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 4	61	34	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
GROSS HIF1A TARGETS DN	25	15	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A UP	142	104	All SZGR 2.0 genes in this pathway
BENPORATH ES 1	379	235	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS	179	105	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN	357	212	All SZGR 2.0 genes in this pathway
TCGA GLIOBLASTOMA COPY NUMBER UP	75	36	All SZGR 2.0 genes in this pathway
CERVERA SDHB TARGETS 1 DN	38	22	All SZGR 2.0 genes in this pathway
BROCKE APOPTOSIS REVERSED BY IL6	144	98	All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS UP	108	75	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS UP	214	133	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS DN	215	132	All SZGR 2.0 genes in this pathway
MCCOLLUM GELDANAMYCIN RESISTANCE DN	7	6	All SZGR 2.0 genes in this pathway
WANG LSD1 TARGETS UP	24	14	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS UP	170	107	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
CONRAD STEM CELL	39	27	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
KORKOLA EMBRYONIC CARCINOMA VS SEMINOMA UP	22	15	All SZGR 2.0 genes in this pathway
WONG EMBRYONIC STEM CELL CORE	335	193	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS	289	187	All SZGR 2.0 genes in this pathway
DUAN PRDM5 TARGETS	79	52	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP	163	111	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7	403	240	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN	106	77	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4	227	149	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-129-5p	768	774	m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
				hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
				hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
				hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-132/212	758	764	1A	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	758	764	1A	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-182	535	541	m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-200bc/429	477	483	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-21	522	528	m8	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	522	528	m8	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-382	1055	1061	1A	hsa-miR-382^brain	GAAGUUGUUCGUGGUGGAUUCG
miR-450	768	774	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-450	768	774	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-493-5p	659	665	1A	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SOX2