Gene Page: DST
Summary ?
GeneID | 667 |
Symbol | DST |
Synonyms | BP240|BPA|BPAG1|CATX-15|CATX15|D6S1101|DMH|DT|EBSB2|HSAN6|MACF2 |
Description | dystonin |
Reference | MIM:113810|HGNC:HGNC:1090|Ensembl:ENSG00000151914|HPRD:00222|Vega:OTTHUMG00000014913 |
Gene type | protein-coding |
Map location | 6p12.1 |
Pascal p-value | 3.458E-6 |
Sherlock p-value | 0.942 |
Fetal beta | -1.064 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias,schizotypal | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 1.9568 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg05022673 | 6 | 56819429 | DST;BEND6 | 6.58E-5 | -0.26 | 0.024 | DMG:Wockner_2014 |
cg12152867 | 6 | 56708725 | DST | 9.43E-5 | -0.27 | 0.027 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10915848 | chr1 | 225788919 | DST | 667 | 0.16 | trans | ||
rs17029291 | chr3 | 32402138 | DST | 667 | 0 | trans | ||
rs1610001 | chr13 | 100484419 | DST | 667 | 0.06 | trans | ||
rs1324669 | chr13 | 107872446 | DST | 667 | 0.02 | trans | ||
rs3742829 | chr14 | 73489267 | DST | 667 | 0.19 | trans | ||
rs16958358 | chr17 | 55502410 | DST | 667 | 0.02 | trans | ||
rs6015314 | chr20 | 57167224 | DST | 667 | 0.12 | trans | ||
rs17145698 | chrX | 40218345 | DST | 667 | 0.08 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
COL15A1 | 0.58 | 0.18 |
COL6A3 | 0.57 | 0.26 |
RP11-291I6.1 | 0.56 | 0.29 |
ITIH2 | 0.56 | 0.21 |
NID2 | 0.55 | 0.21 |
MMRN1 | 0.55 | 0.33 |
NID1 | 0.55 | 0.28 |
COL4A1 | 0.54 | 0.27 |
SLCO2A1 | 0.53 | 0.20 |
OSR1 | 0.53 | 0.28 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TCEAL3 | -0.28 | -0.18 |
AL132868.3 | -0.27 | -0.20 |
GLIPR1L2 | -0.27 | -0.29 |
TSR2 | -0.25 | -0.19 |
SLCO1A2 | -0.24 | -0.20 |
HDAC11 | -0.24 | -0.14 |
C5orf53 | -0.24 | -0.20 |
CCNI2 | -0.24 | -0.19 |
MAG | -0.23 | -0.17 |
GJC2 | -0.23 | -0.18 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
GO:0005178 | integrin binding | IPI | 11375975 | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005515 | protein binding | IPI | 17043677 | |
GO:0005198 | structural molecule activity | IEA | - | |
GO:0008022 | protein C-terminus binding | IPI | 11375975 | |
GO:0008017 | microtubule binding | IEA | - | |
GO:0051015 | actin filament binding | ISS | 8575775 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008090 | retrograde axon cargo transport | IEA | axon (GO term level: 9) | - |
GO:0007155 | cell adhesion | IEA | - | |
GO:0007229 | integrin-mediated signaling pathway | NAS | 11375975 | |
GO:0007010 | cytoskeleton organization | TAS | 10428034 | |
GO:0007050 | cell cycle arrest | IEA | - | |
GO:0030036 | actin cytoskeleton organization | ISS | 8575775 | |
GO:0031110 | regulation of microtubule polymerization or depolymerization | IEA | - | |
GO:0031122 | cytoplasmic microtubule organization | IEA | - | |
GO:0045104 | intermediate filament cytoskeleton organization | IEP | 11751855 | |
GO:0045104 | intermediate filament cytoskeleton organization | ISS | - | |
GO:0045104 | intermediate filament cytoskeleton organization | NAS | 11375975 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0060053 | neurofilament cytoskeleton | IEA | neuron (GO term level: 10) | - |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005604 | basement membrane | TAS | 2461961 | |
GO:0005737 | cytoplasm | IDA | 11751855 | |
GO:0005737 | cytoplasm | ISS | 8575775 | |
GO:0016023 | cytoplasmic membrane-bounded vesicle | IDA | 14581450 | |
GO:0015630 | microtubule cytoskeleton | IEA | - | |
GO:0015629 | actin cytoskeleton | IEA | - | |
GO:0030056 | hemidesmosome | IEA | - | |
GO:0030056 | hemidesmosome | TAS | 8575775 |11375975 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID TAP63 PATHWAY | 54 | 40 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
LIU SOX4 TARGETS UP | 137 | 94 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE DN | 84 | 53 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL DN | 198 | 110 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST LOBULAR CARCINOMA VS DUCTAL NORMAL DN | 91 | 53 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST LOBULAR CARCINOMA VS LOBULAR NORMAL UP | 94 | 59 | All SZGR 2.0 genes in this pathway |
WILCOX RESPONSE TO PROGESTERONE DN | 66 | 44 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
GAL LEUKEMIC STEM CELL UP | 133 | 78 | All SZGR 2.0 genes in this pathway |
JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP | 182 | 110 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 2 UP | 139 | 83 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA UP | 171 | 112 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA BY DMOG UP | 130 | 85 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A AND HIF2A TARGETS DN | 104 | 72 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
GRAHAM NORMAL QUIESCENT VS NORMAL DIVIDING UP | 66 | 47 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS UP | 149 | 84 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 DN | 229 | 142 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 XPCS DN | 88 | 71 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 TTD DN | 84 | 63 | All SZGR 2.0 genes in this pathway |
HUMMERICH SKIN CANCER PROGRESSION DN | 100 | 64 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
TOMLINS PROSTATE CANCER DN | 40 | 33 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
WANG PROSTATE CANCER ANDROGEN INDEPENDENT | 66 | 37 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
SASAKI ADULT T CELL LEUKEMIA | 176 | 122 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C8 | 72 | 56 | All SZGR 2.0 genes in this pathway |
TAKAO RESPONSE TO UVB RADIATION UP | 86 | 55 | All SZGR 2.0 genes in this pathway |
NATSUME RESPONSE TO INTERFERON BETA UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
LIAN LIPA TARGETS 6M | 74 | 47 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR DN | 148 | 102 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR DN | 101 | 70 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 8HR DN | 47 | 31 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
WEIGEL OXIDATIVE STRESS BY HNE AND TBH | 60 | 42 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P7 | 90 | 52 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 8G | 95 | 62 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G | 171 | 96 | All SZGR 2.0 genes in this pathway |
COATES MACROPHAGE M1 VS M2 UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
SARRIO EPITHELIAL MESENCHYMAL TRANSITION DN | 154 | 101 | All SZGR 2.0 genes in this pathway |
DE YY1 TARGETS DN | 92 | 64 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
BASSO HAIRY CELL LEUKEMIA DN | 80 | 66 | All SZGR 2.0 genes in this pathway |
HUPER BREAST BASAL VS LUMINAL UP | 54 | 29 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
POOLA INVASIVE BREAST CANCER DN | 134 | 83 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SURVIVAL DN | 113 | 76 | All SZGR 2.0 genes in this pathway |
KESHELAVA MULTIPLE DRUG RESISTANCE | 88 | 56 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 30MIN DN | 150 | 99 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 2HR DN | 49 | 33 | All SZGR 2.0 genes in this pathway |
NOUSHMEHR GBM SOMATIC MUTATED | 9 | 7 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN | 103 | 67 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY LUMINAL PROGENITOR DN | 14 | 9 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 345 | 351 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-134 | 190 | 196 | 1A | hsa-miR-134brain | UGUGACUGGUUGACCAGAGGG |
miR-142-3p | 318 | 324 | 1A | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
miR-496 | 56 | 62 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-539 | 873 | 880 | 1A,m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.