SZGR2

Summary ?

GeneID	6670
Symbol	SP3
Synonyms	SPR2
Description	Sp3 transcription factor
Reference	MIM:601804\|HGNC:HGNC:11208\|Ensembl:ENSG00000172845\|HPRD:03483\|Vega:OTTHUMG00000132333
Gene type	protein-coding
Map location	2q31
Pascal p-value	0.238
Sherlock p-value	0.494
Fetal beta	1.162

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0333

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RAB11FIP4	0.87	0.89
PCNXL2	0.84	0.88
FBXO10	0.84	0.84
RHOBTB2	0.83	0.89
OSBP2	0.82	0.85
C4orf50	0.82	0.85
GABBR2	0.82	0.83
CAMK2B	0.82	0.84
CNNM1	0.82	0.83
FBXO41	0.82	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
GNG11	-0.44	-0.50
AF347015.21	-0.43	-0.41
C1orf54	-0.43	-0.50
AL139819.3	-0.43	-0.44
SAT1	-0.43	-0.49
C1orf61	-0.42	-0.49
AP002478.3	-0.41	-0.45
S100A13	-0.40	-0.39
ACAA2	-0.40	-0.41
MYL12A	-0.39	-0.52

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0003682	chromatin binding	IEA		-
GO:0003690	double-stranded DNA binding	IEA		-
GO:0005515	protein binding	IPI		14667819 \|16696853
GO:0008270	zinc ion binding	IEA		-
GO:0016564	transcription repressor activity	NAS		9278495
GO:0016563	transcription activator activity	NAS		9278495
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001779	natural killer cell differentiation	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	IDA		12560508
GO:0030224	monocyte differentiation	IEA		-
GO:0006350	transcription	IEA		-
GO:0030218	erythrocyte differentiation	IEA		-
GO:0030217	T cell differentiation	IEA		-
GO:0030851	granulocyte differentiation	IEA		-
GO:0030183	B cell differentiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IC		12560508

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	-	HPRD,BioGRID	10547281
GABPA	E4TF1-60 \| E4TF1A \| NFT2 \| NRF2 \| NRF2A	GA binding protein transcription factor, alpha subunit 60kDa	-	HPRD,BioGRID	11237613
GRIN1	NMDA1 \| NMDAR1 \| NR1	glutamate receptor, ionotropic, N-methyl D-aspartate 1	-	HPRD	14970236
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD,BioGRID	12176973
HDAC2	RPD3 \| YAF1	histone deacetylase 2	-	HPRD,BioGRID	12151407
PIAS1	DDXBP1 \| GBP \| GU/RH-II \| MGC141878 \| MGC141879 \| ZMIZ3	protein inhibitor of activated STAT, 1	-	HPRD,BioGRID	12356736
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD	7732011
RBBP4	NURF55 \| RBAP48	retinoblastoma binding protein 4	Affinity Capture-Western	BioGRID	12091390
RBBP4	NURF55 \| RBAP48	retinoblastoma binding protein 4	-	HPRD	12943729
SENP1	SuPr-2	SUMO1/sentrin specific peptidase 1	SENP1 desumoylates sumoylated SP3. This interaction was modeled on a demonstrated interaction between SENP1 from an unspecified species and SP3 from an unspecified species.	BIND	15546615
SP1	-	Sp1 transcription factor	-	HPRD	9329821
SP4	HF1B \| MGC130008 \| MGC130009 \| SPR-1	Sp4 transcription factor	Phenotypic Suppression	BioGRID	7559627
STK19	D6S60 \| D6S60E \| G11 \| HLA-RP1 \| MGC117388 \| RP1	serine/threonine kinase 19	-	HPRD,BioGRID	14667819
TNFSF10	APO2L \| Apo-2L \| CD253 \| TL2 \| TRAIL	tumor necrosis factor (ligand) superfamily, member 10	SP3 interacts with the TNFSF10 promoter.	BIND	15619633
ZBTB7A	DKFZp547O146 \| FBI-1 \| FBI1 \| LRF \| MGC99631 \| ZBTB7 \| ZNF857A \| pokemon	zinc finger and BTB domain containing 7A	-	HPRD	12004059

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA CALCINEURIN PATHWAY	21	17	All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY	68	48	All SZGR 2.0 genes in this pathway
RODRIGUES DCC TARGETS DN	121	84	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP	276	165	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP	341	197	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP	177	113	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION	77	51	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION CCNE1	40	26	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
IIZUKA LIVER CANCER PROGRESSION G1 G2 DN	25	18	All SZGR 2.0 genes in this pathway
CHESLER BRAIN HIGHEST EXPRESSION	40	29	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP	390	242	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 6HR	59	38	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 12HR	35	23	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 12	36	18	All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C2	18	15	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS	108	71	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C0	107	72	All SZGR 2.0 genes in this pathway
MMS MOUSE LYMPH HIGH 4HRS UP	36	20	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 3HR	74	47	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN	220	147	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA RADIATION	81	59	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP	226	164	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN	120	81	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
VANLOO SP3 TARGETS DN	89	47	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	141	147	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124.1	141	147	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	141	147	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	141	147	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-129-5p	93	99	m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
				hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
				hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
				hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-133	801	807	1A	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	801	807	1A	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-135	886	892	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
				hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
				hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
				hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-145	418	424	1A	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-153	920	926	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-155	554	560	m8	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-182	654	661	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-186	678	684	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-188	603	609	1A	hsa-miR-188	CAUCCCUUGCAUGGUGGAGGGU
miR-194	466	472	1A	hsa-miR-194	UGUAACAGCAACUCCAUGUGGA
miR-208	825	831	m8	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-223	439	446	1A,m8	hsa-miR-223	UGUCAGUUUGUCAAAUACCCC
miR-30-3p	134	140	m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	134	140	m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-363	91	97	1A	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-369-3p	1362	1369	1A,m8	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	1363	1370	1A,m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-410	241	248	1A,m8	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-448	919	926	1A,m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-450	93	99	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-452	922	929	1A,m8	hsa-miR-452	UGUUUGCAGAGGAAACUGAGAC
miR-485-3p	151	157	m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU
miR-493-5p	539	546	1A,m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-493-5p	539	546	1A,m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-505	626	632	1A	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC
miR-543	464	470	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-93.hd/291-3p/294/295/302/372/373/520	1048	1054	1A	hsa-miR-93^brain	AAAGUGCUGUUCGUGCAGGUAG
				hsa-miR-302a	UAAGUGCUUCCAUGUUUUGGUGA
				hsa-miR-302b	UAAGUGCUUCCAUGUUUUAGUAG
				hsa-miR-302c	UAAGUGCUUCCAUGUUUCAGUGG
				hsa-miR-302d	UAAGUGCUUCCAUGUUUGAGUGU
				hsa-miR-372	AAAGUGCUGCGACAUUUGAGCGU
				hsa-miR-373	GAAGUGCUUCGAUUUUGGGGUGU
				hsa-miR-520e	AAAGUGCUUCCUUUUUGAGGG
				hsa-miR-520a	AAAGUGCUUCCCUUUGGACUGU
				hsa-miR-520b	AAAGUGCUUCCUUUUAGAGGG
				hsa-miR-520c	AAAGUGCUUCCUUUUAGAGGGUU
				hsa-miR-520d	AAAGUGCUUCUCUUUGGUGGGUU
miR-96	655	661	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SP3