Gene Page: SRI
Summary ?
| GeneID | 6717 |
| Symbol | SRI |
| Synonyms | CP-22|CP22|SCN|V19 |
| Description | sorcin |
| Reference | MIM:182520|HGNC:HGNC:11292|Ensembl:ENSG00000075142|HPRD:01680|Vega:OTTHUMG00000157267 |
| Gene type | protein-coding |
| Map location | 7q21.1 |
| Pascal p-value | 0.074 |
| Fetal beta | -1.345 |
| DMG | 1 (# studies) |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias,schizotypal | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg22579218 | 7 | 87848722 | SRI | 1.78E-8 | -0.028 | 6.41E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005102 | receptor binding | TAS | Neurotransmitter (GO term level: 4) | 9668070 |
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005246 | calcium channel regulator activity | TAS | 9668070 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001508 | regulation of action potential | TAS | 9668070 | |
| GO:0007165 | signal transduction | TAS | 16130169 | |
| GO:0007517 | muscle development | TAS | 9668070 | |
| GO:0007507 | heart development | TAS | 9668070 | |
| GO:0008016 | regulation of heart contraction | TAS | 9668070 | |
| GO:0006810 | transport | TAS | 9668070 | |
| GO:0006942 | regulation of striated muscle contraction | TAS | 9668070 | |
| GO:0006880 | intracellular sequestering of iron ion | TAS | 9668070 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | TAS | 16130169 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
| NEWMAN ERCC6 TARGETS UP | 26 | 18 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 DN | 281 | 186 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS UP | 149 | 84 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN | 142 | 95 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN | 153 | 100 | All SZGR 2.0 genes in this pathway |
| WANG ESOPHAGUS CANCER VS NORMAL UP | 121 | 72 | All SZGR 2.0 genes in this pathway |
| OUELLET CULTURED OVARIAN CANCER INVASIVE VS LMP UP | 69 | 40 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
| POMEROY MEDULLOBLASTOMA PROGNOSIS DN | 43 | 28 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| TAKAO RESPONSE TO UVB RADIATION UP | 86 | 55 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS MATURE CELL | 293 | 160 | All SZGR 2.0 genes in this pathway |
| KAAB FAILED HEART ATRIUM DN | 141 | 99 | All SZGR 2.0 genes in this pathway |
| KANG FLUOROURACIL RESISTANCE UP | 22 | 15 | All SZGR 2.0 genes in this pathway |
| MAHAJAN RESPONSE TO IL1A DN | 76 | 57 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV SCC UP | 123 | 75 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
| ZHENG FOXP3 TARGETS IN THYMUS UP | 196 | 137 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
| MASSARWEH RESPONSE TO ESTRADIOL | 61 | 47 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER WITH H3K27ME3 UP | 295 | 149 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
| ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
| ZHAN VARIABLE EARLY DIFFERENTIATION GENES DN | 30 | 19 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G3 UP | 188 | 121 | All SZGR 2.0 genes in this pathway |
| HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
| GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
| DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| KRIEG KDM3A TARGETS NOT HYPOXIA | 208 | 107 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-142-5p | 131 | 137 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| miR-542-3p | 534 | 540 | m8 | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.