SZGR2

Summary ?

GeneID	672
Symbol	BRCA1
Synonyms	BRCAI\|BRCC1\|BROVCA1\|FANCS\|IRIS\|PNCA4\|PPP1R53\|PSCP\|RNF53
Description	breast cancer 1
Reference	MIM:113705\|HGNC:HGNC:1100\|Ensembl:ENSG00000012048\|HPRD:00218\|Vega:OTTHUMG00000157426
Gene type	protein-coding
Map location	17q21
Pascal p-value	0.013
Sherlock p-value	0.658
Fetal beta	1.161
eGene	Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1208

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg25738236	17	41278652	BRCA1;NBR2	5.63E-5	0.416	0.022	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
GO:0003677	DNA binding	IEA		-
GO:0003684	damaged DNA binding	IEA		-
GO:0003713	transcription coactivator activity	NAS		15572661
GO:0005515	protein binding	IEA		-
GO:0004842	ubiquitin-protein ligase activity	NAS		15905410
GO:0008270	zinc ion binding	IEA		-
GO:0008270	zinc ion binding	TAS		8944023
GO:0015631	tubulin binding	NAS		12214252
GO:0019899	enzyme binding	IPI		15965487
GO:0046872	metal ion binding	IEA		-
GO:0050681	androgen receptor binding	NAS		15572661
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000075	cell cycle checkpoint	NAS		-
GO:0000724	double-strand break repair via homologous recombination	IDA		17349954
GO:0009048	dosage compensation, by inactivation of X chromosome	IEA		-
GO:0006359	regulation of transcription from RNA polymerase III promoter	TAS		10918303
GO:0006357	regulation of transcription from RNA polymerase II promoter	TAS		10910365
GO:0006301	postreplication repair	IDA		17349954
GO:0006281	DNA repair	IEA		-
GO:0006260	DNA replication	IEA		-
GO:0008630	DNA damage response, signal transduction resulting in induction of apoptosis	IDA		14654789
GO:0007098	centrosome cycle	IEA		-
GO:0006978	DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator	TAS		10918303
GO:0007059	chromosome segregation	IMP		15965487
GO:0042981	regulation of apoptosis	TAS		10918303
GO:0016481	negative regulation of transcription	IDA		16288014
GO:0042127	regulation of cell proliferation	TAS		10918303
GO:0043009	chordate embryonic development	IEA		-
GO:0031398	positive regulation of protein ubiquitination	IDA		15965487
GO:0030521	androgen receptor signaling pathway	NAS		15572661
GO:0045739	positive regulation of DNA repair	NAS		12242698
GO:0045893	positive regulation of transcription, DNA-dependent	NAS		15572661
GO:0045717	negative regulation of fatty acid biosynthetic process	IMP		16326698
GO:0045786	negative regulation of cell cycle	IEA		-
GO:0043627	response to estrogen stimulus	IDA		8895509
GO:0046600	negative regulation of centriole replication	NAS		12214252
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000151	ubiquitin ligase complex	NAS		14976165
GO:0000793	condensed chromosome	IEA		-
GO:0005575	cellular_component	ND		-
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005634	nucleus	TAS		10918303
GO:0005654	nucleoplasm	EXP		10550055
GO:0005737	cytoplasm	IEA		-
GO:0008274	gamma-tubulin ring complex	NAS		12214252
GO:0031436	BRCA1-BARD1 complex	IDA		15265711

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	Affinity Capture-Western	BioGRID	12024016
ACACA	ACAC \| ACC \| ACC1 \| ACCA	acetyl-Coenzyme A carboxylase alpha	-	HPRD,BioGRID	12360400
ACACA	ACAC \| ACC \| ACC1 \| ACCA	acetyl-Coenzyme A carboxylase alpha	BRCA1 interacts with acetyl-CoA carboxylase.	BIND	12360400
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	Reconstituted Complex	BioGRID	10542266
APLP2	APPH \| APPL2 \| CDEBP	amyloid beta (A4) precursor-like protein 2	Far Western	BioGRID	11746496
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD,BioGRID	11016951 \|11085509
ATF1	EWS-ATF1 \| FUS/ATF-1 \| TREB36	activating transcription factor 1	-	HPRD,BioGRID	10945975
ATM	AT1 \| ATA \| ATC \| ATD \| ATDC \| ATE \| DKFZp781A0353 \| MGC74674 \| TEL1 \| TELO1	ataxia telangiectasia mutated	Affinity Capture-Western Co-purification Protein-peptide Reconstituted Complex	BioGRID	10550055 \|10608806 \|10783165 \|10866324 \|11016625 \|11114888 \|11278964
ATM	AT1 \| ATA \| ATC \| ATD \| ATDC \| ATE \| DKFZp781A0353 \| MGC74674 \| TEL1 \| TELO1	ataxia telangiectasia mutated	-	HPRD	2001833
ATR	FRP1 \| MEC1 \| SCKL \| SCKL1	ataxia telangiectasia and Rad3 related	BRCA1 physically and functionally interacts with ATR during genotoxic stress	BIND	11016625 \|11278964
ATR	FRP1 \| MEC1 \| SCKL \| SCKL1	ataxia telangiectasia and Rad3 related	Affinity Capture-Western Protein-peptide Reconstituted Complex	BioGRID	10608806 \|11016625 \|11114888 \|11278964
AURKA	AIK \| ARK1 \| AURA \| AURORA2 \| BTAK \| MGC34538 \| STK15 \| STK6 \| STK7	aurora kinase A	Affinity Capture-Western Reconstituted Complex	BioGRID	14990569
BACH1	-	BTB and CNC homology 1, basic leucine zipper transcription factor 1	-	HPRD,BioGRID	11301010
BAP1	DKFZp686N04275 \| FLJ35406 \| FLJ37180 \| HUCEP-13 \| KIAA0272 \| UCHL2 \| hucep-6	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	-	HPRD	9528852
BARD1	-	BRCA1 associated RING domain 1	Affinity Capture-MS Affinity Capture-Western Co-crystal Structure Co-localization Co-purification FRET Reconstituted Complex Two-hybrid	BioGRID	8944023 \|9342365 \|9738006 \|9788437 \|10026184 \|10477523 \|10635334 \|11257228 \|11278247 \|11301010 \|11498787 \|11504724 \|11526114 \|11573085 \|11773071 \|11925436 \|11927591 \|12431996 \|12438698 \|12485996 \|12700228 \|12732733 \|12887909 \|12890688 \|12951069 \|14636569 \|14638690 \|14647430 \|15159397 \|15184379
BARD1	-	BRCA1 associated RING domain 1	-	HPRD	8944023 \|10026184 \|11573085 \|11773071 \|12431996
BARD1	-	BRCA1 associated RING domain 1	-	HPRD	8944023 \|10026184 \|11773071 \|12431996
BLM	BS \| MGC126616 \| MGC131618 \| MGC131620 \| RECQ2 \| RECQL2 \| RECQL3	Bloom syndrome	Co-purification	BioGRID	10783165
BRAP	BRAP2 \| IMP \| RNF52	BRCA1 associated protein	-	HPRD,BioGRID	9497340
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	Co-crystal Structure Protein-peptide Reconstituted Complex	BioGRID	9525870 \|11573086 \|14578343
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	BRCA1 possesses E3 ubiquitin ligase activity and auto-ubiquitinates	BIND	11320250
BRCA2	BRCC2 \| FACD \| FAD \| FAD1 \| FANCB \| FANCD \| FANCD1	breast cancer 2, early onset	-	HPRD,BioGRID	9774970
BRCA2	BRCC2 \| FACD \| FAD \| FAD1 \| FANCB \| FANCD \| FANCD1	breast cancer 2, early onset	BRCA1 interacts with BRCA2.	BIND	9774970
BRCC3	BRCC36 \| C6.1A \| CXorf53	BRCA1/BRCA2-containing complex, subunit 3	Affinity Capture-MS Affinity Capture-Western Co-purification	BioGRID	14636569
BRE	BRCC4 \| BRCC45	brain and reproductive organ-expressed (TNFRSF1A modulator)	Affinity Capture-MS Affinity Capture-Western Co-purification	BioGRID	14636569
BRIP1	BACH1 \| FANCJ \| FLJ90232 \| MGC126521 \| MGC126523 \| OF	BRCA1 interacting protein C-terminal helicase 1	Affinity Capture-MS Affinity Capture-Western Co-crystal Structure Protein-peptide Reconstituted Complex	BioGRID	11877378 \|14576433 \|14578343 \|15133502 \|15208681 \|15242590
BRIP1	BACH1 \| FANCJ \| FLJ90232 \| MGC126521 \| MGC126523 \| OF	BRCA1 interacting protein C-terminal helicase 1	-	HPRD	11301010
CCNA1	-	cyclin A1	BRCA1 associates with Cyclin A	BIND	9244350 \|10373534
CCNA1	-	cyclin A1	Reconstituted Complex	BioGRID	9244350
CCNA2	CCN1 \| CCNA	cyclin A2	-	HPRD,BioGRID	9244350 \|10373534
CCNB1	CCNB	cyclin B1	-	HPRD,BioGRID	9244350
CCNB1	CCNB	cyclin B1	BRCA1 is a tyrosine phosphoprotein that associates with Cyclin B1	BIND	9244350
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	-	HPRD,BioGRID	9244350
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	BRCA1 associates with Cyclin D1	BIND	9244350
CCNE1	CCNE	cyclin E1	Affinity Capture-Western	BioGRID	17525332
CDC2	CDC28A \| CDK1 \| DKFZp686L20222 \| MGC111195	cell division cycle 2, G1 to S and G2 to M	-	HPRD,BioGRID	9244350
CDK2	p33(CDK2)	cyclin-dependent kinase 2	BRCA1 associates with CDK2	BIND	9244350 \|10373534
CDK2	p33(CDK2)	cyclin-dependent kinase 2	Affinity Capture-Western Reconstituted Complex	BioGRID	8764100 \|9244350 \|10373534
CDK4	CMM3 \| MGC14458 \| PSK-J3	cyclin-dependent kinase 4	-	HPRD,BioGRID	9244350
CDK4	CMM3 \| MGC14458 \| PSK-J3	cyclin-dependent kinase 4	BRCA1 associates with CDK4	BIND	9244350
CDK5	PSSALRE	cyclin-dependent kinase 5	Reconstituted Complex	BioGRID	9244350
CDK8	K35 \| MGC126074 \| MGC126075	cyclin-dependent kinase 8	Co-purification	BioGRID	9159119
CDS1	CDS	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	Reconstituted Complex	BioGRID	12438214
CHEK2	CDS1 \| CHK2 \| HuCds1 \| LFS2 \| PP1425 \| RAD53	CHK2 checkpoint homolog (S. pombe)	-	HPRD,BioGRID	10724175
CLSPN	CLASPIN \| MGC131612 \| MGC131613 \| MGC131615	claspin homolog (Xenopus laevis)	-	HPRD,BioGRID	15096610
COBRA1	DKFZp586B0519 \| KIAA1182 \| NELF-B \| NELFB	cofactor of BRCA1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	11739404
COBRA1	DKFZp586B0519 \| KIAA1182 \| NELF-B \| NELFB	cofactor of BRCA1	-	HPRD	12612062
CREB1	CREB \| MGC9284	cAMP responsive element binding protein 1	Phenotypic Enhancement	BioGRID	10945975
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	-	HPRD,BioGRID	10655477
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	CBP interacts with BRCA1. This interaction was modelled on a demonstrated interaction between human BRCA1 and mouse CBP.	BIND	10655477
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	-	HPRD,BioGRID	10403822
CSNK2B	CK2B \| CK2N \| CSK2B \| G5A \| MGC138222 \| MGC138224	casein kinase 2, beta polypeptide	Reconstituted Complex Two-hybrid	BioGRID	10403822
CSNK2B	CK2B \| CK2N \| CSK2B \| G5A \| MGC138222 \| MGC138224	casein kinase 2, beta polypeptide	BRCA1 is phosphorylated by Casein kinase 2 through a physical interaction with CSNK2B	BIND	10403822
CSTF1	CstF-50 \| CstFp50	cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa	Reconstituted Complex	BioGRID	11257228
CSTF2	CstF-64	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	Affinity Capture-Western Co-purification	BioGRID	10477523 \|11257228
CTBP1	BARS \| MGC104684	C-terminal binding protein 1	-	HPRD,BioGRID	10196224
CTCFL	BORIS \| CTCF-T \| MGC163358 \| dJ579F20.2	CCCTC-binding factor (zinc finger protein)-like	Protein-peptide	BioGRID	14578343
DHX9	DDX9 \| LKP \| NDHII \| RHA	DEAH (Asp-Glu-Ala-His) box polypeptide 9	-	HPRD	9662397\|12592385
DHX9	DDX9 \| LKP \| NDHII \| RHA	DEAH (Asp-Glu-Ala-His) box polypeptide 9	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9662397 \|12592385
DNAJA3	FLJ45758 \| TID1 \| hTid-1	DnaJ (Hsp40) homolog, subfamily A, member 3	Protein-peptide	BioGRID	14578343
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	BRCA1 associates with E2F-1	BIND	9244350
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	-	HPRD	9244350
E2F4	E2F-4	E2F transcription factor 4, p107/p130-binding	BRCA1 associates with E2F-4	BIND	9244350
E2F4	E2F-4	E2F transcription factor 4, p107/p130-binding	-	HPRD,BioGRID	9244350
ELK1	-	ELK1, member of ETS oncogene family	-	HPRD	11313879
ELK4	SAP1	ELK4, ETS-domain protein (SRF accessory protein 1)	Affinity Capture-Western Reconstituted Complex	BioGRID	11313879
EP300	KAT3B \| p300	E1A binding protein p300	-	HPRD,BioGRID	10655477
EP300	KAT3B \| p300	E1A binding protein p300	p300 interacts with BRCA1.	BIND	10655477
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	-	HPRD	10334989
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	Affinity Capture-Western Co-localization Reconstituted Complex	BioGRID	11244506 \|11493692 \|11782371 \|12400015
ETS1	ETS-1 \| EWSR2 \| FLJ10768	v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)	Reconstituted Complex	BioGRID	11313879
ETS2	ETS2IT1	v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)	ETS2 (Ets-2) interacts with BRCA1 promoter. This interaction was modeled on a demonstrated interaction between ETS2 from an unspecified species and BRCA1 promoter from an unspecified species.	BIND	12637547
FANCA	FA \| FA-H \| FA1 \| FAA \| FACA \| FAH \| FANCH \| MGC75158	Fanconi anemia, complementation group A	BRCA1 interacts with FANCA.	BIND	12354784
FANCA	FA \| FA-H \| FA1 \| FAA \| FACA \| FAH \| FANCH \| MGC75158	Fanconi anemia, complementation group A	-	HPRD,BioGRID	12354784
FANCD2	DKFZp762A223 \| FA-D2 \| FA4 \| FACD \| FAD \| FAD2 \| FANCD \| FLJ23826	Fanconi anemia, complementation group D2	Co-localization Reconstituted Complex Two-hybrid	BioGRID	12887909 \|14499622
FANCD2	DKFZp762A223 \| FA-D2 \| FA4 \| FACD \| FAD \| FAD2 \| FANCD \| FLJ23826	Fanconi anemia, complementation group D2	-	HPRD	11239454
FHL2	AAG11 \| DRAL \| SLIM3	four and a half LIM domains 2	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	14550570 \|14986435
FLI1	EWSR2 \| SIC-1	Friend leukemia virus integration 1	Reconstituted Complex	BioGRID	11313879
FLNA	ABP-280 \| ABPX \| DKFZp434P031 \| FLN \| FLN1 \| FMD \| MNS \| NHBP \| OPD \| OPD1 \| OPD2	filamin A, alpha (actin binding protein 280)	-	HPRD	11602572
GTF2E1	FE \| TF2E1 \| TFIIE-A	general transcription factor IIE, polypeptide 1, alpha 56kDa	Co-purification	BioGRID	9159119
GTF2F1	BTF4 \| RAP74 \| TF2F1 \| TFIIF	general transcription factor IIF, polypeptide 1, 74kDa	Co-purification	BioGRID	9159119
GTF2H4	TFB2 \| TFIIH	general transcription factor IIH, polypeptide 4, 52kDa	Co-purification	BioGRID	9159119
H2AFX	H2A.X \| H2A/X \| H2AX	H2A histone family, member X	Co-localization Reconstituted Complex	BioGRID	10959836 \|11927591 \|12485996
H2AFY	H2A.y \| H2A/y \| H2AF12M \| H2AFJ \| MACROH2A1.1 \| mH2A1 \| macroH2A1.2	H2A histone family, member Y	Co-localization	BioGRID	12419249
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	BRCA1 interacts with HDAC1	BIND	10220405
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD,BioGRID	10220405
HDAC2	RPD3 \| YAF1	histone deacetylase 2	-	HPRD,BioGRID	10220405
HDAC2	RPD3 \| YAF1	histone deacetylase 2	BRCA1 interacts with HDAC2	BIND	10220405
HIST2H2AC	H2A \| H2A-GL101 \| H2A/q \| H2AFQ \| MGC74460	histone cluster 2, H2ac	Reconstituted Complex	BioGRID	11927591
HIST2H3C	H3 \| H3.2 \| H3/M \| H3F2 \| H3FM \| MGC9629	histone cluster 2, H3c	Co-localization	BioGRID	12419249
HSPA8	HSC54 \| HSC70 \| HSC71 \| HSP71 \| HSP73 \| HSPA10 \| LAP1 \| MGC131511 \| MGC29929 \| NIP71	heat shock 70kDa protein 8	Two-hybrid	BioGRID	9738006
JAK1	JAK1A \| JAK1B \| JTK3	Janus kinase 1 (a protein tyrosine kinase)	-	HPRD,BioGRID	11163768
JAK2	JTK10	Janus kinase 2 (a protein tyrosine kinase)	-	HPRD,BioGRID	11163768
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	BRCA1 interacts with c-Jun.	BIND	12080089
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	12080089
JUNB	AP-1	jun B proto-oncogene	BRCA1 interacts with JunB.	BIND	12080089
JUNB	AP-1	jun B proto-oncogene	-	HPRD,BioGRID	12080089
JUND	AP-1	jun D proto-oncogene	-	HPRD,BioGRID	12080089
JUND	AP-1	jun D proto-oncogene	BRCA1 interacts with JunD.	BIND	12080089
KIF1B	CMT2 \| CMT2A \| CMT2A1 \| FLJ23699 \| HMSNII \| KIAA0591 \| KIAA1448 \| KLP \| MGC134844	kinesin family member 1B	Protein-peptide	BioGRID	14578343
KPNA2	IPOA1 \| QIP2 \| RCH1 \| SRP1alpha	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	Two-hybrid	BioGRID	8955125
KPNA2	IPOA1 \| QIP2 \| RCH1 \| SRP1alpha	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	-	HPRD	9497340
LMO4	-	LIM domain only 4	-	HPRD,BioGRID	11751867
LMO4	-	LIM domain only 4	The LIM domain protein LMO4 interacts with BRCA1	BIND	11751867
MAP3K3	MAPKKK3 \| MEKK3	mitogen-activated protein kinase kinase kinase 3	Affinity Capture-Western Two-hybrid	BioGRID	15205325
MAP3K3	MAPKKK3 \| MEKK3	mitogen-activated protein kinase kinase kinase 3	BRCA1 interacts with MEKK3.	BIND	15205325
MAP4K4	FLH21957 \| FLJ10410 \| FLJ20373 \| FLJ90111 \| HGK \| KIAA0687 \| NIK	mitogen-activated protein kinase kinase kinase kinase 4	Protein-peptide	BioGRID	14578343
MDC1	DKFZp781A0122 \| KIAA0170 \| MGC166888 \| NFBD1	mediator of DNA damage checkpoint 1	-	HPRD	12607005
MDC1	DKFZp781A0122 \| KIAA0170 \| MGC166888 \| NFBD1	mediator of DNA damage checkpoint 1	Affinity Capture-Western	BioGRID	17525332
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	BRCA1 interacts with TRAP220.	BIND	15208681
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	Affinity Capture-MS Affinity Capture-Western Reconstituted Complex	BioGRID	15208681
MED13	ARC250 \| DRIP250 \| HSPC221 \| KIAA0593 \| THRAP1 \| TRAP240	mediator complex subunit 13	Affinity Capture-MS	BioGRID	15208681
MED17	CRSP6 \| CRSP77 \| DRIP80 \| FLJ10812 \| TRAP80	mediator complex subunit 17	Affinity Capture-MS Co-purification	BioGRID	11504724 \|12154023 \|15208681
MED21	SRB7 \| SURB7	mediator complex subunit 21	-	HPRD,BioGRID	9159119
MED23	CRSP130 \| CRSP133 \| CRSP3 \| DKFZp434H0117 \| DRIP130 \| SUR2	mediator complex subunit 23	Affinity Capture-MS	BioGRID	15208681
MED24	ARC100 \| CRSP100 \| CRSP4 \| DRIP100 \| KIAA0130 \| MGC8748 \| THRAP4 \| TRAP100	mediator complex subunit 24	Affinity Capture-MS Affinity Capture-Western	BioGRID	15208681
MLH1	COCA2 \| FCC2 \| HNPCC \| HNPCC2 \| MGC5172 \| hMLH1	mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)	-	HPRD,BioGRID	10783165
MRE11A	ATLD \| HNGS1 \| MRE11 \| MRE11B	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	Affinity Capture-Western Co-localization Co-purification Reconstituted Complex	BioGRID	10426999 \|10783165 \|11353843 \|11504724
MSH2	COCA1 \| FCC1 \| HNPCC \| HNPCC1 \| LCFS2	mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)	-	HPRD,BioGRID	11498787
MSH2	COCA1 \| FCC1 \| HNPCC \| HNPCC1 \| LCFS2	mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)	BRCA1 interacts with MSH2 in the absence of ADP-MSH2 interaction.	BIND	10783165
MSH3	DUP \| MGC163306 \| MGC163308 \| MRP1	mutS homolog 3 (E. coli)	Protein-peptide Reconstituted Complex	BioGRID	11498787 \|14578343
MSH6	GTBP \| HNPCC5 \| HSAP	mutS homolog 6 (E. coli)	BRCA1 associates with MSH6.	BIND	10783165 \|11498787
MSH6	GTBP \| HNPCC5 \| HSAP	mutS homolog 6 (E. coli)	-	HPRD,BioGRID	11498787
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	-	HPRD,BioGRID	9788437
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	BRCA1 association with c-Myc, a proto-oncogene that is implicated in tumorigenesis, embryonic development and apoptosis, inhibits its transcriptional and transforming activity in cells.	BIND	9788437
NBN	AT-V1 \| AT-V2 \| ATV \| FLJ10155 \| MGC87362 \| NBS \| NBS1 \| P95	nibrin	-	HPRD,BioGRID	10426999 \|10783165
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	Protein-peptide Reconstituted Complex	BioGRID	11085509 \|14578343
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	Protein-peptide	BioGRID	14578343
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	-	HPRD	12700228
NFYA	CBF-A \| CBF-B \| FLJ11236 \| HAP2 \| NF-YA	nuclear transcription factor Y, alpha	-	HPRD,BioGRID	11777930
NFYA	CBF-A \| CBF-B \| FLJ11236 \| HAP2 \| NF-YA	nuclear transcription factor Y, alpha	BRCA1 interacts with NF-YA	BIND	11777930
NMI	-	N-myc (and STAT) interactor	-	HPRD,BioGRID	11916966
NMI	-	N-myc (and STAT) interactor	BRCA1 interacts with Nmi.	BIND	11916966
NPM1	B23 \| MGC104254 \| NPM	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	Affinity Capture-MS Affinity Capture-Western Reconstituted Complex	BioGRID	15184379
NUFIP1	NUFIP \| bA540M5.1	nuclear fragile X mental retardation protein interacting protein 1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	15107825
NUFIP1	NUFIP \| bA540M5.1	nuclear fragile X mental retardation protein interacting protein 1	BRCA1 interacts with NUFIP.	BIND	15107825
NUP153	HNUP153 \| N153	nucleoporin 153kDa	Protein-peptide	BioGRID	14578343
ORC2L	ORC2	origin recognition complex, subunit 2-like (yeast)	Affinity Capture-Western	BioGRID	17525332
ORC3L	LAT \| LATHEO \| ORC3	origin recognition complex, subunit 3-like (yeast)	Affinity Capture-Western	BioGRID	17525332
PCTK1	FLJ16665 \| PCTAIRE \| PCTAIRE1 \| PCTGAIRE	PCTAIRE protein kinase 1	Two-hybrid	BioGRID	9738006
PEG3	DKFZp781A095 \| KIAA0287 \| PW1 \| ZSCAN24	paternally expressed 3	Far Western	BioGRID	11746496
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	-	HPRD	4506230 \|9159119 \|12154023\|10725406
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	-	HPRD	4506230 \|9159119 \|12154023
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	Affinity Capture-Western Co-purification	BioGRID	9159119 \|11504724 \|12955082 \|14506230
POLR2K	ABC10-alpha \| RPABC4 \| RPB10alpha \| RPB12 \| RPB7.0 \| hRPB7.0 \| hsRPB10a	polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa	-	HPRD	10725406
POU2F1	OCT1 \| OTF1	POU class 2 homeobox 1	Affinity Capture-Western	BioGRID	11777930
POU2F1	OCT1 \| OTF1	POU class 2 homeobox 1	BRCA1 interacts with Oct-1.	BIND	11777930
PPP1CA	MGC15877 \| MGC1674 \| PP-1A \| PPP1A	protein phosphatase 1, catalytic subunit, alpha isoform	Affinity Capture-Western Reconstituted Complex	BioGRID	12438214
PRKDC	DNA-PKcs \| DNAPK \| DNPK1 \| HYRC \| HYRC1 \| XRCC7 \| p350	protein kinase, DNA-activated, catalytic polypeptide	Protein-peptide	BioGRID	10608806
RAD50	RAD50-2 \| hRad50	RAD50 homolog (S. cerevisiae)	-	HPRD,BioGRID	10426999
RAD51	BRCC5 \| HRAD51 \| HsRad51 \| HsT16930 \| RAD51A \| RECA	RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)	-	HPRD,BioGRID	9774970
RAD51	BRCC5 \| HRAD51 \| HsRad51 \| HsT16930 \| RAD51A \| RECA	RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)	BRCA1 and Rad51 associate in mitotic and meiotic cells	BIND	9008167
RAD51	BRCC5 \| HRAD51 \| HsRad51 \| HsT16930 \| RAD51A \| RECA	RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)	-	HPRD	9008167 \|9774970\|9774970
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD,BioGRID	10220405
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	BRCA1 interacts with Rb.	BIND	10518542
RBBP4	NURF55 \| RBAP48	retinoblastoma binding protein 4	BRCA1 interacts with RbAp48.	BIND	10220405
RBBP4	NURF55 \| RBAP48	retinoblastoma binding protein 4	-	HPRD,BioGRID	10220405
RBBP7	MGC138867 \| MGC138868 \| RbAp46	retinoblastoma binding protein 7	BRCA1 interacts with RbAp46.	BIND	10220405
RBBP7	MGC138867 \| MGC138868 \| RbAp46	retinoblastoma binding protein 7	-	HPRD,BioGRID	10220405
RBBP8	CTIP \| RIM	retinoblastoma binding protein 8	-	HPRD	9738006 \|10196224
RBBP8	CTIP \| RIM	retinoblastoma binding protein 8	Affinity Capture-Western Protein-peptide Reconstituted Complex Two-hybrid	BioGRID	9738006 \|9811458 \|10196224 \|10764811 \|10910365 \|11689934 \|14578343
RBBP8	CTIP \| RIM	retinoblastoma binding protein 8	BRCA1 interacts with CtIP.	BIND	9811458
RBL1	CP107 \| MGC40006 \| PRB1 \| p107	retinoblastoma-like 1 (p107)	Co-localization Reconstituted Complex	BioGRID	11521194
RBL2	FLJ26459 \| P130 \| Rb2	retinoblastoma-like 2 (p130)	Co-localization Reconstituted Complex	BioGRID	11521194
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	-	HPRD,BioGRID	12700228
RFC1	A1 \| MGC51786 \| MHCBFB \| PO-GA \| RECC1 \| RFC \| RFC140	replication factor C (activator 1) 1, 145kDa	-	HPRD,BioGRID	10783165
RPL31	MGC88191	ribosomal protein L31	Far Western Reconstituted Complex	BioGRID	11746496
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	BRCA1 interacts with Smad2. This interaction was modeled on a demonstrated interaction between BRCA1 from human and Smad2 from an unspecified species.	BIND	15735739
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	BRCA1 interacts with Smad3.	BIND	15735739
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	BRCA1 interacts with Smad4. This interaction was modeled on a demonstrated interaction between BRCA1 from human and Smad4 from an unspecified species.	BIND	15735739
SMARCA2	BAF190 \| BRM \| FLJ36757 \| MGC74511 \| SNF2 \| SNF2L2 \| SNF2LA \| SWI2 \| Sth1p \| hBRM \| hSNF2a	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	Affinity Capture-Western	BioGRID	15034933
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	-	HPRD,BioGRID	10943845
SMARCB1	BAF47 \| INI1 \| RDT \| SNF5 \| SNF5L1 \| Sfh1p \| Snr1 \| hSNFS	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	Co-purification	BioGRID	10943845
SMARCC1	BAF155 \| CRACC1 \| Rsc8 \| SRG3 \| SWI3	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	Co-purification	BioGRID	10943845
SMARCC2	BAF170 \| CRACC2 \| Rsc8	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	Co-purification	BioGRID	10943845
SMARCD2	BAF60B \| CRACD2 \| PRO2451 \| Rsc6p	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	Co-purification	BioGRID	10943845
SMC1A	CDLS2 \| DKFZp686L19178 \| DXS423E \| KIAA0178 \| MGC138332 \| SB1.8 \| SMC1 \| SMC1L1 \| SMC1alpha \| SMCB	structural maintenance of chromosomes 1A	-	HPRD	11877377
SP1	-	Sp1 transcription factor	-	HPRD	10720440
SP1	-	Sp1 transcription factor	BRCA1 interacts with Sp1.	BIND	12706836
SP1	-	Sp1 transcription factor	Affinity Capture-Western	BioGRID	12706836
STAT1	DKFZp686B04100 \| ISGF-3 \| STAT91	signal transducer and activator of transcription 1, 91kDa	-	HPRD,BioGRID	10792030
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	-	HPRD	11163768
STAT5A	MGF \| STAT5	signal transducer and activator of transcription 5A	-	HPRD,BioGRID	12459499
TOP2A	TOP2 \| TP2A	topoisomerase (DNA) II alpha 170kDa	TOP2A (Topo II) interacts with BRCA1	BIND	15965487
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	BRCA1a interacts with p53.	BIND	9926942
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	BRCA1 physically associates with p53 and stimulates its transcriptional activity	BIND	9582019
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	9482880
TP53BP1	53BP1 \| FLJ41424 \| MGC138366 \| p202	tumor protein p53 binding protein 1	Affinity Capture-Western	BioGRID	17525332
TUBG1	TUBG \| TUBGCP1	tubulin, gamma 1	-	HPRD,BioGRID	9789027 \|11691781
UBA1	A1S9 \| A1S9T \| A1ST \| AMCX1 \| GXP1 \| MGC4781 \| SMAX2 \| UBA1A \| UBE1 \| UBE1X	ubiquitin-like modifier activating enzyme 1	Reconstituted Complex	BioGRID	11278247 \|11927591 \|12438698 \|12485996 \|12887909 \|14638690 \|15184379
UBB	FLJ25987 \| MGC8385	ubiquitin B	BRCA1 interacts with Ub. This interaction was modelled on a demonstrated interaction between human BRCA1 and Ub from an unspecified source.	BIND	11320250
UBE2D1	E2(17)KB1 \| SFT \| UBC4/5 \| UBCH5 \| UBCH5A	ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)	Reconstituted Complex	BioGRID	11278247 \|11927591 \|12438698 \|12485996 \|12732733 \|12887909 \|12890688 \|14636569 \|14638690 \|15184379
UBE2D3	E2(17)KB3 \| MGC43926 \| MGC5416 \| UBC4/5 \| UBCH5C	ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)	-	HPRD	12732733
UBE2L3	E2-F1 \| L-UBC \| UBCH7 \| UbcM4	ubiquitin-conjugating enzyme E2L 3	-	HPRD,BioGRID	12732733
UBE3A	ANCR \| AS \| E6-AP \| EPVE6AP \| FLJ26981 \| HPVE6A	ubiquitin protein ligase E3A	Reconstituted Complex	BioGRID	12890688
USF2	FIP \| bHLHb12	upstream transcription factor 2, c-fos interacting	-	HPRD,BioGRID	14502648
VCP	IBMPFD \| MGC131997 \| MGC148092 \| MGC8560 \| TERA \| p97	valosin-containing protein	-	HPRD,BioGRID	10855792
WNT2B	WNT13 \| XWNT2	wingless-type MMTV integration site family, member 2B	Far Western	BioGRID	11746496
XIST	DKFZp779P0129 \| DXS1089 \| DXS399E \| NCRNA00001 \| SXI1 \| XCE \| XIC \| swd66	X (inactive)-specific transcript (non-protein coding)	Co-localization	BioGRID	12419249 \|15065664
XRCC1	RCC	X-ray repair complementing defective repair in Chinese hamster cells 1	-	HPRD	11352725
ZCCHC8	DKFZp434E2220	zinc finger, CCHC domain containing 8	Affinity Capture-Western	BioGRID	17525332
ZNF350	ZBRK1 \| ZFQR	zinc finger protein 350	-	HPRD,BioGRID	11090615

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG UBIQUITIN MEDIATED PROTEOLYSIS	138	98	All SZGR 2.0 genes in this pathway
BIOCARTA ATM PATHWAY	20	16	All SZGR 2.0 genes in this pathway
BIOCARTA CARM ER PATHWAY	35	27	All SZGR 2.0 genes in this pathway
BIOCARTA G2 PATHWAY	24	20	All SZGR 2.0 genes in this pathway
BIOCARTA ATRBRCA PATHWAY	21	12	All SZGR 2.0 genes in this pathway
PID FANCONI PATHWAY	47	28	All SZGR 2.0 genes in this pathway
PID E2F PATHWAY	74	48	All SZGR 2.0 genes in this pathway
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
PID ATM PATHWAY	34	25	All SZGR 2.0 genes in this pathway
PID ATF2 PATHWAY	59	43	All SZGR 2.0 genes in this pathway
PID ERA GENOMIC PATHWAY	65	37	All SZGR 2.0 genes in this pathway
PID AURORA A PATHWAY	31	20	All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY	63	52	All SZGR 2.0 genes in this pathway
PID BARD1 PATHWAY	29	19	All SZGR 2.0 genes in this pathway
PID HNF3A PATHWAY	44	29	All SZGR 2.0 genes in this pathway
REACTOME MEIOSIS	116	81	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME HOMOLOGOUS RECOMBINATION REPAIR OF REPLICATION INDEPENDENT DOUBLE STRAND BREAKS	17	11	All SZGR 2.0 genes in this pathway
REACTOME FANCONI ANEMIA PATHWAY	25	11	All SZGR 2.0 genes in this pathway
REACTOME DOUBLE STRAND BREAK REPAIR	24	14	All SZGR 2.0 genes in this pathway
REACTOME DNA REPAIR	112	59	All SZGR 2.0 genes in this pathway
REACTOME CHROMOSOME MAINTENANCE	122	80	All SZGR 2.0 genes in this pathway
REACTOME MEIOTIC RECOMBINATION	86	62	All SZGR 2.0 genes in this pathway
REACTOME MEIOTIC SYNAPSIS	73	57	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN	663	425	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
SCIBETTA KDM5B TARGETS DN	81	55	All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP	181	101	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP	633	376	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP	128	95	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP	117	84	All SZGR 2.0 genes in this pathway
LAU APOPTOSIS CDKN2A UP	55	40	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 UP	329	196	All SZGR 2.0 genes in this pathway
MARKEY RB1 ACUTE LOF DN	228	137	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
BUSA SAM68 TARGETS DN	6	5	All SZGR 2.0 genes in this pathway
KONG E2F3 TARGETS	97	58	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION	77	51	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER UP	181	108	All SZGR 2.0 genes in this pathway
WAKASUGI HAVE ZNF143 BINDING SITES	58	33	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 12	11	8	All SZGR 2.0 genes in this pathway
ROSTY CERVICAL CANCER PROLIFERATION CLUSTER	140	73	All SZGR 2.0 genes in this pathway
XU HGF TARGETS REPRESSED BY AKT1 DN	95	58	All SZGR 2.0 genes in this pathway
XU AKT1 TARGETS 6HR	27	18	All SZGR 2.0 genes in this pathway
XU AKT1 TARGETS 48HR	9	6	All SZGR 2.0 genes in this pathway
YORDY RECIPROCAL REGULATION BY ETS1 AND SP100 DN	87	48	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO BEXAROTENE UP	34	17	All SZGR 2.0 genes in this pathway
KARAKAS TGFB1 SIGNALING	18	15	All SZGR 2.0 genes in this pathway
PUJANA XPRSS INT NETWORK	168	103	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
PUJANA BRCA CENTERED NETWORK	117	72	All SZGR 2.0 genes in this pathway
OHM METHYLATED IN ADULT CANCERS	27	23	All SZGR 2.0 genes in this pathway
OHM EMBRYONIC CARCINOMA UP	6	5	All SZGR 2.0 genes in this pathway
KAUFFMANN MELANOMA RELAPSE UP	61	25	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE UP	167	92	All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION UP	69	55	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
GEORGES CELL CYCLE MIR192 TARGETS	62	46	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE DN	75	43	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPAIR GENES	230	137	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPLICATION GENES	147	87	All SZGR 2.0 genes in this pathway
MENSSEN MYC TARGETS	53	35	All SZGR 2.0 genes in this pathway
KANNAN TP53 TARGETS DN	21	15	All SZGR 2.0 genes in this pathway
RADAEVA RESPONSE TO IFNA1 UP	52	40	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA DN	289	166	All SZGR 2.0 genes in this pathway
MAGRANGEAS MULTIPLE MYELOMA IGG VS IGA DN	26	16	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER CIPROFIBRATE UP	60	42	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 DN	163	115	All SZGR 2.0 genes in this pathway
NGUYEN NOTCH1 TARGETS UP	29	23	All SZGR 2.0 genes in this pathway
NAKAJIMA MAST CELL	46	34	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP	314	201	All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH DN	58	43	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR UP	180	125	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 3	101	64	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN	287	208	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
SARRIO EPITHELIAL MESENCHYMAL TRANSITION UP	180	114	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
FUJII YBX1 TARGETS DN	202	132	All SZGR 2.0 genes in this pathway
HOQUE METHYLATED IN CANCER	56	45	All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP	425	253	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
GOLDRATH ANTIGEN RESPONSE	346	192	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN	185	116	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS DN	89	50	All SZGR 2.0 genes in this pathway
CROONQUIST IL6 DEPRIVATION DN	98	69	All SZGR 2.0 genes in this pathway
UROSEVIC RESPONSE TO IMIQUIMOD	23	14	All SZGR 2.0 genes in this pathway
KOBAYASHI EGFR SIGNALING 24HR DN	251	151	All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT DN	222	141	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE LITERATURE	44	25	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE S	162	86	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN	374	217	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP	324	193	All SZGR 2.0 genes in this pathway
THILLAINADESAN ZNF217 TARGETS UP	44	22	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
YU BAP1 TARGETS	29	21	All SZGR 2.0 genes in this pathway
ZHOU CELL CYCLE GENES IN IR RESPONSE 6HR	85	49	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-132/212	1242	1248	m8	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	1242	1248	m8	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BRCA1