Gene Page: ST14
Summary ?
| GeneID | 6768 |
| Symbol | ST14 |
| Synonyms | ARCI11|HAI|MT-SP1|MTSP1|PRSS14|SNC19|TADG15|TMPRSS14 |
| Description | suppression of tumorigenicity 14 |
| Reference | MIM:606797|HGNC:HGNC:11344|Ensembl:ENSG00000149418|HPRD:06005|Vega:OTTHUMG00000165768 |
| Gene type | protein-coding |
| Map location | 11q24-q25 |
| Pascal p-value | 0.052 |
| Fetal beta | -1.262 |
| DMG | 1 (# studies) |
| eGene | Nucleus accumbens basal ganglia Myers' cis & trans Meta |
| Support | G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg10089145 | 11 | 130030103 | ST14 | 3.181E-4 | -0.359 | 0.04 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs10994209 | chr10 | 61877705 | ST14 | 6768 | 0.12 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
| GO:0008233 | peptidase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006508 | proteolysis | TAS | 10373424 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005886 | plasma membrane | TAS | 10373424 |10831593 | |
| GO:0005887 | integral to plasma membrane | TAS | 10831593 | |
| GO:0019897 | extrinsic to plasma membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| LIU PROSTATE CANCER UP | 96 | 57 | All SZGR 2.0 genes in this pathway |
| CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER BASAL VS MESENCHYMAL UP | 121 | 45 | All SZGR 2.0 genes in this pathway |
| JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN | 180 | 101 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D DN | 142 | 90 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
| WAMUNYOKOLI OVARIAN CANCER LMP UP | 265 | 158 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
| COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 3 4WK UP | 214 | 144 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 4 5WK UP | 271 | 175 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL TGFB1 TARGETS UP | 169 | 127 | All SZGR 2.0 genes in this pathway |
| AMUNDSON DNA DAMAGE RESPONSE TP53 | 16 | 9 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER UP | 227 | 137 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| WU CELL MIGRATION | 184 | 114 | All SZGR 2.0 genes in this pathway |
| PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 2 | 50 | 34 | All SZGR 2.0 genes in this pathway |
| NIELSEN SCHWANNOMA UP | 18 | 16 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
| GAVIN IL2 RESPONSIVE FOXP3 TARGETS UP | 19 | 12 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
| WALLACE PROSTATE CANCER UP | 20 | 14 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS UP | 170 | 107 | All SZGR 2.0 genes in this pathway |
| QI PLASMACYTOMA DN | 100 | 63 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER ESR1 DN | 240 | 153 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G1 UP | 113 | 70 | All SZGR 2.0 genes in this pathway |
| KYNG WERNER SYNDROM AND NORMAL AGING DN | 225 | 124 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA MESENCHYMAL | 216 | 130 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP | 397 | 206 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
| NABA ECM REGULATORS | 238 | 125 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-128 | 115 | 122 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-27 | 116 | 123 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.