Summary ?
GeneID6801
SymbolSTRN
SynonymsSG2NA
Descriptionstriatin
ReferenceMIM:614765|HGNC:HGNC:11424|Ensembl:ENSG00000115808|HPRD:18124|Vega:OTTHUMG00000100959
Gene typeprotein-coding
Map location2p22.2
Pascal p-value3.16E-4
SupportG2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
G2Cdb.humanPSD
G2Cdb.humanPSP

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0585 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005516calmodulin bindingNAS9693043 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008150biological_processND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
GO:0005737cytoplasmIEA-
GO:0016020membraneIEA-

Section IV. Protein-protein interaction annotation

InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CAV1CAV | MSTP085 | VIP21caveolin 1, caveolae protein, 22kDa-HPRD11707266 
CCT299D8.1 | CCT-beta | CCTB | MGC142074 | MGC142076 | PRO1633 | TCP-1-betachaperonin containing TCP1, subunit 2 (beta)Affinity Capture-MSBioGRID18782753 
CCT3CCT-gamma | CCTG | PIG48 | TCP-1-gamma | TRIC5chaperonin containing TCP1, subunit 3 (gamma)Affinity Capture-MSBioGRID18782753 
CCT4CCT-DELTA | Cctd | MGC126164 | MGC126165 | SRBchaperonin containing TCP1, subunit 4 (delta)Affinity Capture-MSBioGRID18782753 
CCT5CCT-epsilon | CCTE | KIAA0098 | TCP-1-epsilonchaperonin containing TCP1, subunit 5 (epsilon)Affinity Capture-MSBioGRID18782753 
CCT6ACCT-zeta | CCT-zeta-1 | CCT6 | Cctz | HTR3 | MGC126214 | MGC126215 | MoDP-2 | TCP-1-zeta | TCP20 | TCPZ | TTCP20chaperonin containing TCP1, subunit 6A (zeta 1)Affinity Capture-MSBioGRID18782753 
CCT6BCCT-zeta-2 | CCTZ-2 | Cctz2 | TCP-1-zeta-2 | TSA303chaperonin containing TCP1, subunit 6B (zeta 2)Affinity Capture-MSBioGRID18782753 
CCT7CCT-ETA | Ccth | MGC110985 | Nip7-1 | TCP-1-etachaperonin containing TCP1, subunit 7 (eta)Affinity Capture-MSBioGRID18782753 
CCT8C21orf112 | Cctq | D21S246 | KIAA0002 | PRED71chaperonin containing TCP1, subunit 8 (theta)Affinity Capture-MSBioGRID18782753 
CTTNBP2C7orf8 | CORTBP2 | FLJ34229 | KIAA1758 | MGC104579 | Orf4cortactin binding protein 2Affinity Capture-MSBioGRID18782753 
CTTNBP2NLDKFZp547A023 | FLJ13278CTTNBP2 N-terminal likeAffinity Capture-MS
Affinity Capture-Western
BioGRID18782753 
ESR1DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1estrogen receptor 1-HPRD15569929 
FAM40AFLJ14743 | KIAA1761 | MGC148091 | RP4-773N10.1family with sequence similarity 40, member AAffinity Capture-MS
Affinity Capture-Western
BioGRID18782753 
FAM40B-family with sequence similarity 40, member BAffinity Capture-MSBioGRID18782753 
FGFR1OP2DKFZp564O1863 | HSPC123-likeFGFR1 oncogene partner 2Affinity Capture-MSBioGRID18782753 
GNAI1Giguanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1-HPRD15569929 
MCCDKFZp762O1615 | FLJ38893 | FLJ46755 | MCC1mutated in colorectal cancersAffinity Capture-MSBioGRID17353931 
MOBKL32C4D | CGI-95 | MGC12264 | MOB1 | MOB3 | PREI3MOB1, Mps One Binder kinase activator-like 3 (yeast)Affinity Capture-MS
Affinity Capture-Western
BioGRID18782753 
PDCD10CCM3 | MGC1212 | MGC24477 | TFAR15programmed cell death 10Affinity Capture-MS
Affinity Capture-Western
BioGRID18782753 
PPP2CAPP2Ac | PP2CA | RP-Cprotein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoformAffinity Capture-MSBioGRID18782753 
PPP2CAPP2Ac | PP2CA | RP-Cprotein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform-HPRD10681496 
PPP2CBPP2CBprotein phosphatase 2 (formerly 2A), catalytic subunit, beta isoformAffinity Capture-MSBioGRID18782753 
PPP2R1AMGC786 | PR65Aprotein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoformAffinity Capture-MSBioGRID18782753 
PPP2R1BMGC26454 | PR65Bprotein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoformAffinity Capture-MSBioGRID18782753 
RP5-1000E10.4DKFZp686A0768 | FLJ21168 | SIKEsuppressor of IKK epsilonAffinity Capture-MSBioGRID18782753 
RP6-213H19.1MASK | MST4serine/threonine protein kinase MST4Affinity Capture-MS
Affinity Capture-Western
BioGRID18782753 
SLMAPFLJ42206 | KIAA1601 | MGC138760 | MGC138761 | SLAPsarcolemma associated proteinAffinity Capture-MSBioGRID18782753 
STK24MST-3 | MST3 | MST3B | STE20 | STK3serine/threonine kinase 24 (STE20 homolog, yeast)Affinity Capture-MS
Affinity Capture-Western
BioGRID17353931 |18782753 
STK25DKFZp686J1430 | SOK1 | YSK1serine/threonine kinase 25 (STE20 homolog, yeast)Affinity Capture-MS
Affinity Capture-Western
BioGRID18782753 
STRN3SG2NAstriatin, calmodulin binding protein 3Affinity Capture-MSBioGRID18782753 
STRN4FLJ35594 | ZIN | zinedinstriatin, calmodulin binding protein 4Affinity Capture-MSBioGRID18782753 
TCP1CCT-alpha | CCT1 | CCTa | D6S230E | TCP-1-alphat-complex 1Affinity Capture-MSBioGRID18782753 
TRAF3IP3DJ434O14.3 | FLJ44151 | MGC117354 | MGC163289 | T3JAMTRAF3 interacting protein 3Affinity Capture-MS
Affinity Capture-Western
BioGRID18782753 


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PID ER NONGENOMIC PATHWAY 4135All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP 404246All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP 457269All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501327All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP 722443All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP 293179All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 16521023All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442892All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988594All SZGR 2.0 genes in this pathway
GOLDRATH HOMEOSTATIC PROLIFERATION 171102All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830547All SZGR 2.0 genes in this pathway
HU GENOTOXIN ACTION DIRECT VS INDIRECT 24HR 5538All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP 518299All SZGR 2.0 genes in this pathway
STAMBOLSKY RESPONSE TO VITAMIN D3 UP 8448All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN 918550All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080713All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1 467251All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/1071871931Ahsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-141/200a5005071A,m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-25/32/92/363/3675915971Ahsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-495175181m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU