Gene Page: SYCP1
Summary ?
| GeneID | 6847 |
| Symbol | SYCP1 |
| Synonyms | CT8|HOM-TES-14|SCP-1|SCP1 |
| Description | synaptonemal complex protein 1 |
| Reference | MIM:602162|HGNC:HGNC:11487|Ensembl:ENSG00000198765|HPRD:03698|Vega:OTTHUMG00000012057 |
| Gene type | protein-coding |
| Map location | 1p13-p12 |
| Pascal p-value | 0.019 |
| eGene | Cerebellum |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| STK32B | 0.87 | 0.80 |
| CCBE1 | 0.86 | 0.74 |
| AKAP7 | 0.84 | 0.77 |
| PROM1 | 0.83 | 0.74 |
| L3MBTL3 | 0.83 | 0.79 |
| NKAIN2 | 0.83 | 0.67 |
| KLF6 | 0.82 | 0.78 |
| AXIN2 | 0.82 | 0.79 |
| RPRM | 0.80 | 0.77 |
| CSRP2 | 0.80 | 0.74 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FAM162A | -0.56 | -0.64 |
| HLA-F | -0.55 | -0.69 |
| AIFM3 | -0.55 | -0.68 |
| ALDOC | -0.55 | -0.66 |
| REEP6 | -0.55 | -0.45 |
| CLU | -0.55 | -0.66 |
| TSC22D4 | -0.54 | -0.69 |
| ACOT13 | -0.54 | -0.64 |
| HEPN1 | -0.54 | -0.66 |
| FBXO2 | -0.53 | -0.64 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | TAS | 1464329 | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0005515 | protein binding | ISS | 15944401 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007130 | synaptonemal complex assembly | IEA | Synap (GO term level: 11) | - |
| GO:0007130 | synaptonemal complex assembly | ISS | Synap (GO term level: 11) | 15944401 |
| GO:0007131 | reciprocal meiotic recombination | TAS | 1464329 | |
| GO:0007283 | spermatogenesis | TAS | 1464329 | |
| GO:0007049 | cell cycle | IEA | - | |
| GO:0007126 | meiosis | IEA | - | |
| GO:0051301 | cell division | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000801 | central element | IEA | - | |
| GO:0000802 | transverse filament | IEA | - | |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME MEIOSIS | 116 | 81 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL CYCLE | 421 | 253 | All SZGR 2.0 genes in this pathway |
| REACTOME CHROMOSOME MAINTENANCE | 122 | 80 | All SZGR 2.0 genes in this pathway |
| REACTOME MEIOTIC SYNAPSIS | 73 | 57 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
| WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
| SU TESTIS | 76 | 53 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
| WEBER METHYLATED HCP IN FIBROBLAST DN | 42 | 22 | All SZGR 2.0 genes in this pathway |
| WEBER METHYLATED HCP IN SPERM DN | 28 | 13 | All SZGR 2.0 genes in this pathway |
| MATZUK MEIOTIC AND DNA REPAIR | 39 | 26 | All SZGR 2.0 genes in this pathway |
| MATZUK SPERMATOCYTE | 72 | 55 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3 UNMETHYLATED | 37 | 21 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3 UNMETHYLATED | 228 | 119 | All SZGR 2.0 genes in this pathway |
| KIM GLIS2 TARGETS UP | 84 | 61 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-186 | 320 | 327 | 1A,m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.