Gene Page: SYN2
Summary ?
| GeneID | 6854 |
| Symbol | SYN2 |
| Synonyms | SYNII |
| Description | synapsin II |
| Reference | MIM:600755|HGNC:HGNC:11495|Ensembl:ENSG00000157152|HPRD:02857|Vega:OTTHUMG00000155335 |
| Gene type | protein-coding |
| Map location | 3p25 |
| Pascal p-value | 0.009 |
| Fetal beta | -2.159 |
| eGene | Anterior cingulate cortex BA24 |
| Support | CANABINOID DOPAMINE EXOCYTOSIS SEROTONIN G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 3 | Link to SZGene |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs12633841 | 3 | 11630252 | SYN2 | ENSG00000157152.12 | 2.05327E-6 | 0.04 | -415624 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TTC14 | 0.91 | 0.75 |
| GSDMB | 0.90 | 0.84 |
| WSB1 | 0.90 | 0.85 |
| AC015813.1 | 0.87 | 0.70 |
| CCDC84 | 0.86 | 0.82 |
| ZNF83 | 0.85 | 0.69 |
| SEC31B | 0.85 | 0.88 |
| AHSA2 | 0.85 | 0.80 |
| HPX | 0.84 | 0.64 |
| AC073995.1 | 0.84 | 0.53 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ITM2A | -0.35 | -0.42 |
| BSG | -0.34 | -0.22 |
| GIMAP5 | -0.34 | -0.36 |
| HLA-C | -0.34 | -0.28 |
| TM4SF18 | -0.33 | -0.35 |
| TM4SF1 | -0.33 | -0.34 |
| IGFBP7 | -0.32 | -0.39 |
| HLA-A | -0.32 | -0.31 |
| GIMAP6 | -0.32 | -0.31 |
| ELTD1 | -0.31 | -0.25 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003824 | catalytic activity | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007269 | neurotransmitter secretion | IEA | neuron, axon, Synap, serotonin, Neurotransmitter, dopamine (GO term level: 8) | - |
| GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 8964517 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0030672 | synaptic vesicle membrane | IEA | Synap (GO term level: 13) | - |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME NEUROTRANSMITTER RELEASE CYCLE | 34 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME DOPAMINE NEUROTRANSMITTER RELEASE CYCLE | 11 | 11 | All SZGR 2.0 genes in this pathway |
| DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
| WANG LSD1 TARGETS DN | 39 | 30 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
| ZHENG GLIOBLASTOMA PLASTICITY DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-139 | 649 | 655 | 1A | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
| miR-153 | 136 | 142 | m8 | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-217 | 138 | 144 | m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
| miR-25/32/92/363/367 | 798 | 805 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA | ||||
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-30-5p | 164 | 170 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-335 | 656 | 662 | m8 | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
| miR-338 | 2207 | 2214 | 1A,m8 | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
| miR-34/449 | 2016 | 2023 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
| miR-34b | 1088 | 1095 | 1A,m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
| miR-378* | 273 | 279 | m8 | hsa-miR-422b | CUGGACUUGGAGUCAGAAGGCC |
| hsa-miR-422a | CUGGACUUAGGGUCAGAAGGCC | ||||
| miR-410 | 2277 | 2283 | m8 | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-448 | 1707 | 1713 | m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| miR-542-3p | 2108 | 2114 | 1A | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.