|
|
| GeneID |
6861
|
| Symbol |
SYT5
|
| Synonyms |
-
|
| Description |
synaptotagmin V |
| See related |
HGNC:11513|MIM:600782|Ensembl:ENSG00000129990|HPRD:02870| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
19q|11p |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
| WDR85 | 0.87 | 0.85 | | |
| RHOT2 | 0.87 | 0.84 | | |
| FBXL6 | 0.87 | 0.87 | | |
| TUBGCP6 | 0.86 | 0.85 | | |
| ANKS3 | 0.86 | 0.86 | | |
| RP3-402G11.1 | 0.86 | 0.82 | | |
| RFNG | 0.85 | 0.87 | | |
| ZNF276 | 0.85 | 0.85 | | |
| CPT1B | 0.85 | 0.81 | | |
| CDK9 | 0.85 | 0.82 | | |
Top 10 negatively co-expressed genes | | AF347015.31 | -0.58 | -0.58 | | |
| AF347015.27 | -0.57 | -0.58 | | |
| AF347015.21 | -0.55 | -0.64 | | |
| MT-CO2 | -0.54 | -0.56 | | |
| MT-CYB | -0.54 | -0.54 | | |
| AF347015.8 | -0.53 | -0.55 | | |
| MT-ATP8 | -0.50 | -0.61 | | |
| AF347015.15 | -0.50 | -0.52 | | |
| AF347015.33 | -0.49 | -0.51 | | |
| AF347015.2 | -0.49 | -0.53 | | |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005509 | calcium ion binding | IEA | | - |
| GO:0005215 | transporter activity | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 9177789 |
| GO:0006810 | transport | IEA | | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0043025 | cell soma | IEA | axon, dendrite (GO term level: 4) | - |
| GO:0008021 | synaptic vesicle | IEA | Synap, Neurotransmitter (GO term level: 12) | - |
| GO:0043005 | neuron projection | IEA | neuron, axon, neurite, dendrite (GO term level: 5) | - |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0055038 | recycling endosome membrane | IEA | | - |
| GO:0005794 | Golgi apparatus | IDA | | 18029348 |
| GO:0005768 | endosome | IEA | | - |
| GO:0016020 | membrane | IEA | | - |
| GO:0016021 | integral to membrane | IEA | | - |
| GO:0048471 | perinuclear region of cytoplasm | IEA | | - |
| GO:0030054 | cell junction | IEA | | - |
| GO:0031410 | cytoplasmic vesicle | IEA | | - |
| |
|
|
| |
|
|
| miR-219 | 293 | 300 | 1A,m8 | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU | | miR-330 | 287 | 294 | 1A,m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|