Summary ?
GeneID6899
SymbolTBX1
SynonymsCAFS|CATCH22|CTHM|DGCR|DGS|DORV|TBX1C|TGA|VCF|VCFS
DescriptionT-box 1
ReferenceMIM:602054|HGNC:HGNC:11592|Ensembl:ENSG00000184058|HPRD:09069|Vega:OTTHUMG00000150421
Gene typeprotein-coding
Map location22q11.21
Pascal p-value0.177
Fetal beta-0.747

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CNV:YESCopy number variation studiesManual curation
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
AssociationA combined odds ratio method (Sun et al. 2008), association studies2Link to SZGene
GSMA_IGenome scan meta-analysisPsr: 0.031 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
C4orf480.550.52
MRPS260.530.44
ALDH16A10.520.44
NME40.520.49
NOSIP0.520.42
ZNF7870.520.48
AC018648.10.510.50
HSD17B100.510.39
MRPS340.510.39
C6orf2260.510.42
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
UGP2-0.28-0.29
AKTIP-0.27-0.30
GALNTL5-0.27-0.28
CHN1-0.27-0.21
FRG1B-0.27-0.32
EFR3A-0.26-0.29
ZNF365-0.26-0.26
OSBPL1A-0.26-0.25
VSNL1-0.26-0.19
ELL2-0.26-0.26

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIDA11111039 
GO:0003702RNA polymerase II transcription factor activityNAS9268629 
GO:0042803protein homodimerization activityIDA11111039 
GO:0043565sequence-specific DNA bindingIDA11111039 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006357regulation of transcription from RNA polymerase II promoterNAS9268629 
GO:0007507heart developmentIMP14585638 
GO:0060037pharyngeal system developmentIMP14585638 
GO:0060017parathyroid gland developmentIMP14585638 
GO:0048703embryonic viscerocranium morphogenesisIMP14585638 
GO:0048538thymus developmentIMP14585638 
GO:0060023soft palate developmentIMP14585638 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA15703190 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREY DN 7444All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 16521023All SZGR 2.0 genes in this pathway
SCHLESINGER METHYLATED DE NOVO IN CANCER 8864All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP 13187All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE DN 261183All SZGR 2.0 genes in this pathway
BRUNEAU SEPTATION VENTRICULAR 108All SZGR 2.0 genes in this pathway
BRUNEAU HEART GREAT VESSELS AND VALVULOGENESIS 88All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2 356214All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K27ME3 269159All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED 351238All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349234All SZGR 2.0 genes in this pathway
KESHELAVA MULTIPLE DRUG RESISTANCE 8856All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721492All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN 448282All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725838All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1014134191Ahsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-1394144211A,m8hsa-miR-139brainUCUACAGUGCACGUGUCU
miR-1444124191A,m8hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-1822662721Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-962652721A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC