Gene Page: THY1
Summary ?
GeneID | 7070 |
Symbol | THY1 |
Synonyms | CD90|CDw90 |
Description | Thy-1 cell surface antigen |
Reference | MIM:188230|HGNC:HGNC:11801|HPRD:01769|HPRD:11283| |
Gene type | protein-coding |
Map location | 11q23.3 |
Pascal p-value | 0.3 |
Sherlock p-value | 0.17 |
Fetal beta | -2.73 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere |
Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg22978378 | 11 | 119294441 | THY1 | 1.83E-5 | 0.503 | 0.016 | DMG:Wockner_2014 |
cg24421870 | 11 | 119290274 | THY1 | 9.93E-5 | 0.574 | 0.028 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005100 | Rho GTPase activator activity | ISS | - | |
GO:0003674 | molecular_function | ND | - | |
GO:0005178 | integrin binding | IPI | 15004192 | |
GO:0005515 | protein binding | IPI | 7513706 | |
GO:0034235 | GPI anchor binding | ISS | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0050771 | negative regulation of axonogenesis | ISS | axon, neurogenesis (GO term level: 14) | - |
GO:0001525 | angiogenesis | ISS | - | |
GO:0006469 | negative regulation of protein kinase activity | ISS | - | |
GO:0007010 | cytoskeleton organization | ISS | - | |
GO:0008150 | biological_process | ND | - | |
GO:0048041 | focal adhesion formation | ISS | - | |
GO:0016337 | cell-cell adhesion | ISS | - | |
GO:0050870 | positive regulation of T cell activation | ISS | - | |
GO:0050860 | negative regulation of T cell receptor signaling pathway | ISS | - | |
GO:0051281 | positive regulation of release of sequestered calcium ion into cytosol | ISS | - | |
GO:0030336 | negative regulation of cell migration | ISS | - | |
GO:0043547 | positive regulation of GTPase activity | ISS | - | |
GO:0046549 | retinal cone cell development | ISS | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030426 | growth cone | ISS | axon, dendrite (GO term level: 5) | - |
GO:0005575 | cellular_component | ND | - | |
GO:0005783 | endoplasmic reticulum | IDA | 11256614 | |
GO:0009897 | external side of plasma membrane | ISS | - | |
GO:0005886 | plasma membrane | ISS | - | |
GO:0005887 | integral to plasma membrane | TAS | 2864289 | |
GO:0031362 | anchored to external side of plasma membrane | IEA | - | |
GO:0031225 | anchored to membrane | IEA | - | |
GO:0045121 | membrane raft | NAS | 15093746 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION | 118 | 78 | All SZGR 2.0 genes in this pathway |
BIOCARTA TCYTOTOXIC PATHWAY | 14 | 11 | All SZGR 2.0 genes in this pathway |
BIOCARTA THELPER PATHWAY | 14 | 11 | All SZGR 2.0 genes in this pathway |
PID IL4 2PATHWAY | 65 | 43 | All SZGR 2.0 genes in this pathway |
PID INTEGRIN3 PATHWAY | 43 | 25 | All SZGR 2.0 genes in this pathway |
PID AMB2 NEUTROPHILS PATHWAY | 41 | 32 | All SZGR 2.0 genes in this pathway |
PID INTEGRIN2 PATHWAY | 29 | 18 | All SZGR 2.0 genes in this pathway |
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP | 205 | 140 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP | 351 | 230 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA MYELOID DN | 38 | 25 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST LOBULAR CARCINOMA VS DUCTAL NORMAL UP | 69 | 38 | All SZGR 2.0 genes in this pathway |
ROY WOUND BLOOD VESSEL UP | 50 | 30 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 UP | 120 | 73 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA REVERSIBLY DN | 29 | 21 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
WANG ESOPHAGUS CANCER VS NORMAL UP | 121 | 72 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
KANG GIST WITH PDGFRA UP | 50 | 27 | All SZGR 2.0 genes in this pathway |
SUNG METASTASIS STROMA UP | 110 | 70 | All SZGR 2.0 genes in this pathway |
LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
SMITH TERT TARGETS DN | 87 | 69 | All SZGR 2.0 genes in this pathway |
AFFAR YY1 TARGETS DN | 234 | 137 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS 6HR | 59 | 38 | All SZGR 2.0 genes in this pathway |
HENDRICKS SMARCA4 TARGETS UP | 56 | 35 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS 12HR | 35 | 23 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS | 108 | 71 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 7 | 51 | 34 | All SZGR 2.0 genes in this pathway |
JIANG AGING HYPOTHALAMUS UP | 47 | 31 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MISHRA CARCINOMA ASSOCIATED FIBROBLAST UP | 24 | 14 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
ZHENG GLIOBLASTOMA PLASTICITY DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
GRADE COLON AND RECTAL CANCER UP | 285 | 167 | All SZGR 2.0 genes in this pathway |
CROMER TUMORIGENESIS UP | 63 | 36 | All SZGR 2.0 genes in this pathway |
VILIMAS NOTCH1 TARGETS UP | 52 | 41 | All SZGR 2.0 genes in this pathway |
HOFFMANN PRE BI TO LARGE PRE BII LYMPHOCYTE DN | 75 | 61 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
NIELSEN LEIOMYOSARCOMA CNN1 DN | 20 | 18 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS UP | 266 | 142 | All SZGR 2.0 genes in this pathway |
ANASTASSIOU CANCER MESENCHYMAL TRANSITION SIGNATURE | 64 | 40 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 141 | 147 | 1A | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.