Gene Page: TIAM1
Summary ?
GeneID | 7074 |
Symbol | TIAM1 |
Synonyms | - |
Description | T-cell lymphoma invasion and metastasis 1 |
Reference | MIM:600687|HGNC:HGNC:11805|Ensembl:ENSG00000156299|HPRD:02820|Vega:OTTHUMG00000084869 |
Gene type | protein-coding |
Map location | 21q22.11 |
Pascal p-value | 0.005 |
eGene | Cerebellum Putamen basal ganglia |
Support | CompositeSet Darnell FMRP targets Ascano FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0476 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs60443735 | 21 | 32709836 | TIAM1 | ENSG00000156299.8 | 4.25748E-6 | 0.05 | 222454 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005089 | Rho guanyl-nucleotide exchange factor activity | IEA | - | |
GO:0005089 | Rho guanyl-nucleotide exchange factor activity | TAS | 10835422 | |
GO:0005085 | guanyl-nucleotide exchange factor activity | IEA | - | |
GO:0005057 | receptor signaling protein activity | IEA | - | |
GO:0005543 | phospholipid binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0046875 | ephrin receptor binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0050772 | positive regulation of axonogenesis | IEA | axon, neurogenesis (GO term level: 14) | - |
GO:0007165 | signal transduction | IEA | - | |
GO:0048013 | ephrin receptor signaling pathway | IEA | - | |
GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
GO:0035023 | regulation of Rho protein signal transduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ANK1 | ANK | SPH1 | SPH2 | ankyrin 1, erythrocytic | - | HPRD,BioGRID | 10893266 |
ANK3 | ANKYRIN-G | FLJ45464 | ankyrin 3, node of Ranvier (ankyrin G) | Affinity Capture-Western | BioGRID | 10893266 |
CAMK2G | CAMK | CAMK-II | CAMKG | FLJ16043 | MGC26678 | calcium/calmodulin-dependent protein kinase II gamma | - | HPRD | 10212259 |
CD44 | CDW44 | CSPG8 | ECMR-III | HCELL | IN | LHR | MC56 | MDU2 | MDU3 | MGC10468 | MIC4 | MUTCH-I | Pgp1 | CD44 molecule (Indian blood group) | - | HPRD,BioGRID | 10636882 |
GRIN1 | NMDA1 | NMDAR1 | NR1 | glutamate receptor, ionotropic, N-methyl D-aspartate 1 | Tiam1 interacts with NMDA subunit NR1. This interaction was modelled on a demonstrated interaction between human Tiam1 and NR1 from an unspecified species. | BIND | 15721239 |
HRAS | C-BAS/HAS | C-H-RAS | C-HA-RAS1 | CTLO | H-RASIDX | HAMSV | HRAS1 | K-RAS | N-RAS | RASH1 | v-Ha-ras Harvey rat sarcoma viral oncogene homolog | - | HPRD,BioGRID | 12134164 |
MAPK8IP1 | IB1 | JIP-1 | JIP1 | PRKM8IP | mitogen-activated protein kinase 8 interacting protein 1 | - | HPRD,BioGRID | 12024021 |
MAPK8IP2 | IB2 | JIP2 | PRKM8IPL | mitogen-activated protein kinase 8 interacting protein 2 | Affinity Capture-Western | BioGRID | 12024021 |
MYC | bHLHe39 | c-Myc | v-myc myelocytomatosis viral oncogene homolog (avian) | - | HPRD,BioGRID | 12446731 |
NME1 | AWD | GAAD | NB | NBS | NDPK-A | NDPKA | NM23 | NM23-H1 | non-metastatic cells 1, protein (NM23A) expressed in | - | HPRD,BioGRID | 11274357 |
PPP1R9B | FLJ30345 | PPP1R6 | PPP1R9 | SPINO | Spn | protein phosphatase 1, regulatory (inhibitor) subunit 9B | - | HPRD,BioGRID | 12531897 |
PRKCA | AAG6 | MGC129900 | MGC129901 | PKC-alpha | PKCA | PRKACA | protein kinase C, alpha | - | HPRD,BioGRID | 10212259 |
PRKCB | MGC41878 | PKC-beta | PKCB | PRKCB1 | PRKCB2 | protein kinase C, beta | Biochemical Activity | BioGRID | 10212259 |
PRKCD | MAY1 | MGC49908 | PKCD | nPKC-delta | protein kinase C, delta | - | HPRD,BioGRID | 10212259 |
PRKCE | MGC125656 | MGC125657 | PKCE | nPKC-epsilon | protein kinase C, epsilon | - | HPRD,BioGRID | 10212259 |
PRKCG | MGC57564 | PKC-gamma | PKCC | PKCG | SCA14 | protein kinase C, gamma | - | HPRD,BioGRID | 10212259 |
PRKCZ | PKC-ZETA | PKC2 | protein kinase C, zeta | Biochemical Activity | BioGRID | 10212259 |
RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | The GTPase Rac1 specifically interacts with Dbl-homology domain of the nucleotide exchange factor TIAM1. This interaction is modelled on a demonstrated interaction between mouse TIAM1 and human Rac1. | BIND | 11130063 |
RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | - | HPRD,BioGRID | 11130063 |11595749 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | - | HPRD | 12810717 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CHEMOKINE SIGNALING PATHWAY | 190 | 128 | All SZGR 2.0 genes in this pathway |
KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
PID LYSOPHOSPHOLIPID PATHWAY | 66 | 53 | All SZGR 2.0 genes in this pathway |
PID CDC42 PATHWAY | 70 | 51 | All SZGR 2.0 genes in this pathway |
PID ARF6 DOWNSTREAM PATHWAY | 15 | 14 | All SZGR 2.0 genes in this pathway |
PID AJDISS 2PATHWAY | 48 | 38 | All SZGR 2.0 genes in this pathway |
PID ECADHERIN NASCENT AJ PATHWAY | 39 | 33 | All SZGR 2.0 genes in this pathway |
PID TRKR PATHWAY | 62 | 48 | All SZGR 2.0 genes in this pathway |
PID RAC1 REG PATHWAY | 38 | 25 | All SZGR 2.0 genes in this pathway |
PID EPHRINB REV PATHWAY | 30 | 25 | All SZGR 2.0 genes in this pathway |
PID EPHA2 FWD PATHWAY | 19 | 16 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME NRAGE SIGNALS DEATH THROUGH JNK | 43 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE | 60 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA1213 SIGNALLING EVENTS | 74 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION ERYTHROCYTE UP | 157 | 104 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 DN | 67 | 43 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
LANDIS ERBB2 BREAST TUMORS 324 UP | 150 | 93 | All SZGR 2.0 genes in this pathway |
WANG ESOPHAGUS CANCER VS NORMAL DN | 101 | 66 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
SCHAEFFER SOX9 TARGETS IN PROSTATE DEVELOPMENT DN | 45 | 33 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
JECHLINGER EPITHELIAL TO MESENCHYMAL TRANSITION DN | 66 | 47 | All SZGR 2.0 genes in this pathway |
BECKER TAMOXIFEN RESISTANCE DN | 52 | 37 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS UP | 126 | 84 | All SZGR 2.0 genes in this pathway |
FERRANDO T ALL WITH MLL ENL FUSION UP | 87 | 67 | All SZGR 2.0 genes in this pathway |
MARTINEZ RESPONSE TO TRABECTEDIN | 50 | 32 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR UP | 156 | 101 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS PEAK AT 8HR | 39 | 31 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C5 | 46 | 36 | All SZGR 2.0 genes in this pathway |
BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER T4 | 94 | 69 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P4 | 100 | 62 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS | 212 | 121 | All SZGR 2.0 genes in this pathway |
SANSOM WNT PATHWAY REQUIRE MYC | 58 | 43 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
JI CARCINOGENESIS BY KRAS AND STK11 UP | 12 | 7 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
POS HISTAMINE RESPONSE NETWORK | 32 | 22 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D DN | 252 | 155 | All SZGR 2.0 genes in this pathway |
TOOKER GEMCITABINE RESISTANCE DN | 122 | 84 | All SZGR 2.0 genes in this pathway |
BOHN PRIMARY IMMUNODEFICIENCY SYNDROM UP | 47 | 30 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
HINATA NFKB TARGETS KERATINOCYTE UP | 91 | 63 | All SZGR 2.0 genes in this pathway |
ZHAN V1 LATE DIFFERENTIATION GENES UP | 32 | 25 | All SZGR 2.0 genes in this pathway |
MARSON FOXP3 TARGETS UP | 66 | 43 | All SZGR 2.0 genes in this pathway |
STEIN ESR1 TARGETS | 85 | 55 | All SZGR 2.0 genes in this pathway |
STEIN ESTROGEN RESPONSE NOT VIA ESRRA | 18 | 12 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER UP | 307 | 182 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 6HR UP | 229 | 149 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 5 DN | 50 | 31 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS NOT VIA AKT1 UP | 211 | 131 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS VIA AKT1 UP | 281 | 183 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
LINSLEY MIR16 TARGETS | 206 | 127 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
KATSANOU ELAVL1 TARGETS DN | 148 | 88 | All SZGR 2.0 genes in this pathway |
BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE | 151 | 86 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-10 | 1163 | 1170 | 1A,m8 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
miR-141/200a | 745 | 752 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-142-5p | 1448 | 1455 | 1A,m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-17-5p/20/93.mr/106/519.d | 1235 | 1241 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-183 | 1795 | 1801 | m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-21 | 1861 | 1867 | m8 | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
miR-29 | 1780 | 1786 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-320 | 1625 | 1631 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA | ||||
miR-329 | 26 | 32 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
miR-376c | 1830 | 1836 | m8 | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
miR-410 | 1846 | 1852 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-93.hd/291-3p/294/295/302/372/373/520 | 1234 | 1240 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.