Gene Page: HSP90B1
Summary ?
GeneID | 7184 |
Symbol | HSP90B1 |
Synonyms | ECGP|GP96|GRP94|HEL-S-125m|HEL35|TRA1 |
Description | heat shock protein 90kDa beta family member 1 |
Reference | MIM:191175|HGNC:HGNC:12028|Ensembl:ENSG00000166598|HPRD:01860|Vega:OTTHUMG00000170118 |
Gene type | protein-coding |
Map location | 12q24.2-q24.3 |
Pascal p-value | 0.159 |
Sherlock p-value | 0.06 |
Fetal beta | -0.665 |
DMG | 1 (# studies) |
Support | RNA AND PROTEIN SYNTHESIS G2Cdb.humanPSD G2Cdb.humanPSP Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg16721058 | 12 | 104324570 | HSP90B1 | 4.36E-8 | -0.007 | 1.2E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FAT1 | 0.77 | 0.87 |
HEATR5A | 0.76 | 0.78 |
PARD3B | 0.74 | 0.74 |
ANTXR1 | 0.73 | 0.81 |
PIK3C2A | 0.73 | 0.80 |
FAM120C | 0.73 | 0.78 |
STON2 | 0.72 | 0.80 |
TBL1X | 0.72 | 0.85 |
MSI2 | 0.72 | 0.78 |
ITGB8 | 0.71 | 0.82 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TTC9B | -0.29 | -0.31 |
IER5L | -0.29 | -0.20 |
IL32 | -0.28 | -0.35 |
AF347015.21 | -0.27 | -0.16 |
ST20 | -0.26 | -0.35 |
NANOS3 | -0.26 | -0.31 |
AP003068.3 | -0.26 | -0.34 |
SLN | -0.25 | -0.24 |
SLC26A4 | -0.25 | -0.21 |
SYCP3 | -0.25 | -0.24 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003723 | RNA binding | IDA | 11958450 | |
GO:0005509 | calcium ion binding | TAS | 10497210 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0051082 | unfolded protein binding | IEA | - | |
GO:0050750 | low-density lipoprotein receptor binding | IDA | 15082773 | |
GO:0046790 | virion binding | IPI | 11958450 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001666 | response to hypoxia | IDA | 15620698 | |
GO:0006457 | protein folding | IEA | - | |
GO:0006916 | anti-apoptosis | IMP | 10497210 |15192333 | |
GO:0006916 | anti-apoptosis | TAS | 16130169 | |
GO:0015031 | protein transport | NAS | 15845869 | |
GO:0051208 | sequestering of calcium ion | NAS | 15192333 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005792 | microsome | IDA | 10497210 | |
GO:0005829 | cytosol | IDA | 9596688 | |
GO:0005788 | endoplasmic reticulum lumen | IDA | 10497210 | |
GO:0005789 | endoplasmic reticulum membrane | IDA | 10497210 | |
GO:0005783 | endoplasmic reticulum | TAS | 16130169 | |
GO:0048471 | perinuclear region of cytoplasm | IDA | 10497210 | |
GO:0042470 | melanosome | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
APOB | FLDB | apolipoprotein B (including Ag(x) antigen) | - | HPRD,BioGRID | 12397072 |
ASGR1 | ASGPR | CLEC4H1 | Hs.12056 | asialoglycoprotein receptor 1 | - | HPRD | 12167617 |
CSNK2A1 | CK2A1 | CKII | casein kinase 2, alpha 1 polypeptide | - | HPRD,BioGRID | 11557039 |
CSNK2A2 | CK2A2 | CSNK2A1 | FLJ43934 | casein kinase 2, alpha prime polypeptide | - | HPRD,BioGRID | 11557039 |
EIF2AK3 | DKFZp781H1925 | HRI | PEK | PERK | WRS | eukaryotic translation initiation factor 2-alpha kinase 3 | Affinity Capture-Western | BioGRID | 11907036 |
ERBB2 | CD340 | HER-2 | HER-2/neu | HER2 | NEU | NGL | TKR1 | v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) | - | HPRD,BioGRID | 8617772 |
FANCA | FA | FA-H | FA1 | FAA | FACA | FAH | FANCH | MGC75158 | Fanconi anemia, complementation group A | Affinity Capture-MS | BioGRID | 15082718 |
FANCC | FA3 | FAC | FACC | FLJ14675 | Fanconi anemia, complementation group C | Two-hybrid | BioGRID | 14499622 |
HSPA9 | CSA | GRP75 | HSPA9B | MGC4500 | MOT | MOT2 | MTHSP75 | PBP74 | mot-2 | heat shock 70kDa protein 9 (mortalin) | - | HPRD | 12470827 |
LRP1 | A2MR | APOER | APR | CD91 | FLJ16451 | IGFBP3R | LRP | MGC88725 | TGFBR5 | low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) | - | HPRD | 11861214 |
SMARCA4 | BAF190 | BRG1 | FLJ39786 | SNF2 | SNF2-BETA | SNF2L4 | SNF2LB | SWI2 | hSNF2b | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 | Affinity Capture-Western | BioGRID | 11726552 |
SMARCC1 | BAF155 | CRACC1 | Rsc8 | SRG3 | SWI3 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 | Affinity Capture-Western | BioGRID | 11726552 |
SMARCC2 | BAF170 | CRACC2 | Rsc8 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 | Affinity Capture-Western | BioGRID | 11726552 |
TG | AITD3 | TGN | thyroglobulin | - | HPRD,BioGRID | 10049727 |
TLR2 | CD282 | TIL4 | toll-like receptor 2 | - | HPRD | 11912201 |
TLR4 | ARMD10 | CD284 | TOLL | hToll | toll-like receptor 4 | - | HPRD | 11912201 |
VWF | F8VWF | VWD | von Willebrand factor | Affinity Capture-Western | BioGRID | 10887119 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG NOD LIKE RECEPTOR SIGNALING PATHWAY | 62 | 47 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG PROSTATE CANCER | 89 | 75 | All SZGR 2.0 genes in this pathway |
PID IL6 7 PATHWAY | 47 | 40 | All SZGR 2.0 genes in this pathway |
REACTOME TRAFFICKING AND PROCESSING OF ENDOSOMAL TLR | 14 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME DIABETES PATHWAYS | 133 | 91 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATION OF CHAPERONES BY ATF6 ALPHA | 13 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME UNFOLDED PROTEIN RESPONSE | 80 | 51 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATION OF CHAPERONE GENES BY ATF6 ALPHA | 11 | 8 | All SZGR 2.0 genes in this pathway |
REACTOME INNATE IMMUNE SYSTEM | 279 | 178 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME TOLL RECEPTOR CASCADES | 118 | 84 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
HOEBEKE LYMPHOID STEM CELL DN | 86 | 59 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 UP | 120 | 73 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
MORI EMU MYC LYMPHOMA BY ONSET TIME DN | 17 | 9 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS B LYMPHOCYTE UP | 78 | 51 | All SZGR 2.0 genes in this pathway |
STANELLE E2F1 TARGETS | 29 | 20 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION DN | 187 | 122 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE DN | 245 | 154 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
MUNSHI MULTIPLE MYELOMA UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
BASSO CD40 SIGNALING UP | 101 | 76 | All SZGR 2.0 genes in this pathway |
NATSUME RESPONSE TO INTERFERON BETA UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
LEE AGING NEOCORTEX UP | 89 | 59 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC UP | 202 | 115 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS DN | 141 | 92 | All SZGR 2.0 genes in this pathway |
MARCHINI TRABECTEDIN RESISTANCE DN | 49 | 34 | All SZGR 2.0 genes in this pathway |
ZHONG SECRETOME OF LUNG CANCER AND FIBROBLAST | 132 | 93 | All SZGR 2.0 genes in this pathway |
PELLICCIOTTA HDAC IN ANTIGEN PRESENTATION UP | 64 | 40 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
DE YY1 TARGETS DN | 92 | 64 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS DN | 145 | 93 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
TOOKER GEMCITABINE RESISTANCE DN | 122 | 84 | All SZGR 2.0 genes in this pathway |
CHAUHAN RESPONSE TO METHOXYESTRADIOL DN | 102 | 65 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 60HR DN | 277 | 166 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN MYELOMA VS MATURE B LYMPHOCYTE | 101 | 76 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN PLASMA CELL VS MATURE B LYMPHOCYTE | 67 | 51 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN ACTIVATED DENDRITIC CELL | 65 | 49 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT LATE 2 | 277 | 172 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11 | 103 | 68 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
LI DCP2 BOUND MRNA | 89 | 57 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 36HR | 152 | 88 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
VANOEVELEN MYOGENESIS SIN3A TARGETS | 220 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 172 | 178 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-148/152 | 107 | 113 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-181 | 182 | 189 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-223 | 204 | 210 | m8 | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
miR-23 | 38 | 45 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 38 | 44 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-409-3p | 171 | 177 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
miR-496 | 185 | 191 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.