Gene Page: TYRO3
Summary ?
GeneID | 7301 |
Symbol | TYRO3 |
Synonyms | BYK|Dtk|Etk-2|RSE|Rek|Sky|Tif |
Description | TYRO3 protein tyrosine kinase |
Reference | MIM:600341|HGNC:HGNC:12446|HPRD:02641| |
Gene type | protein-coding |
Map location | 15q15 |
Pascal p-value | 0.654 |
Sherlock p-value | 0.976 |
Fetal beta | -1.516 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenic | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs7328038 | chr13 | 65364069 | TYRO3 | 7301 | 0.12 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004714 | transmembrane receptor protein tyrosine kinase activity | TAS | neurite (GO term level: 8) | 7511603 |
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004872 | receptor activity | IEA | - | |
GO:0004716 | receptor signaling protein tyrosine kinase activity | TAS | 7511603 | |
GO:0005515 | protein binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007155 | cell adhesion | TAS | 8108112 | |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0007165 | signal transduction | TAS | 7511603 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 18029348 | |
GO:0005730 | nucleolus | IDA | 18029348 | |
GO:0005737 | cytoplasm | IDA | 18029348 | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 7511603 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE DN | 92 | 51 | All SZGR 2.0 genes in this pathway |
ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
JOHANSSON GLIOMAGENESIS BY PDGFB DN | 21 | 16 | All SZGR 2.0 genes in this pathway |
DARWICHE SKIN TUMOR PROMOTER DN | 185 | 115 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK LOW DN | 165 | 107 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK HIGH DN | 180 | 110 | All SZGR 2.0 genes in this pathway |
DARWICHE SQUAMOUS CELL CARCINOMA DN | 181 | 107 | All SZGR 2.0 genes in this pathway |
AUNG GASTRIC CANCER | 54 | 20 | All SZGR 2.0 genes in this pathway |
WOOD EBV EBNA1 TARGETS UP | 110 | 71 | All SZGR 2.0 genes in this pathway |
CAFFAREL RESPONSE TO THC 24HR 5 DN | 59 | 35 | All SZGR 2.0 genes in this pathway |
COLIN PILOCYTIC ASTROCYTOMA VS GLIOBLASTOMA UP | 35 | 32 | All SZGR 2.0 genes in this pathway |
MODY HIPPOCAMPUS POSTNATAL | 63 | 50 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS UP | 175 | 116 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR UP | 180 | 125 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K27ME3 DN | 228 | 114 | All SZGR 2.0 genes in this pathway |
NAKAMURA METASTASIS MODEL UP | 45 | 26 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
CROONQUIST IL6 DEPRIVATION DN | 98 | 69 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS DN | 87 | 66 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN DN | 88 | 68 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP | 134 | 85 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-22 | 256 | 262 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.