Gene Page: VEGFA
Summary ?
| GeneID | 7422 |
| Symbol | VEGFA |
| Synonyms | MVCD1|VEGF|VPF |
| Description | vascular endothelial growth factor A |
| Reference | MIM:192240|HGNC:HGNC:12680|Ensembl:ENSG00000112715|HPRD:01889|Vega:OTTHUMG00000014745 |
| Gene type | protein-coding |
| Map location | 6p12 |
| Pascal p-value | 0.071 |
| DEG p-value | DEG:Maycox_2009:CC_BA10_fold_change=1.33:CC_BA10_disease_P=0.0309:HBB_BA9_fold_change=1.23:HBB_BA9_disease_P=0.0369 |
| Fetal beta | 1.025 |
| Support | G2Cdb.humanNRC G2Cdb.humanPSP Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DEG:Maycox_2009 | Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue | We included 51 genes whose expression changes are common between two schizophrenia cohorts. | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HELLS | 0.95 | 0.79 |
| KIF23 | 0.95 | 0.75 |
| BUB1 | 0.95 | 0.83 |
| CCNB2 | 0.95 | 0.84 |
| TIMELESS | 0.95 | 0.74 |
| KIF4A | 0.95 | 0.83 |
| BUB1B | 0.95 | 0.81 |
| FANCI | 0.95 | 0.66 |
| MCM10 | 0.95 | 0.81 |
| TPX2 | 0.95 | 0.76 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FBXO2 | -0.47 | -0.68 |
| HLA-F | -0.47 | -0.71 |
| ASPHD1 | -0.46 | -0.66 |
| C5orf53 | -0.46 | -0.70 |
| SLC9A3R2 | -0.46 | -0.53 |
| PTH1R | -0.45 | -0.64 |
| CCNI2 | -0.45 | -0.67 |
| CA4 | -0.45 | -0.74 |
| TNFSF12 | -0.44 | -0.63 |
| LHPP | -0.44 | -0.62 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0001968 | fibronectin binding | IDA | 14570917 | |
| GO:0005161 | platelet-derived growth factor receptor binding | IPI | 17470632 | |
| GO:0008201 | heparin binding | IDA | 15001987 | |
| GO:0008083 | growth factor activity | IEA | - | |
| GO:0043184 | vascular endothelial growth factor receptor 2 binding | IPI | 1417831 | |
| GO:0042803 | protein homodimerization activity | ISS | - | |
| GO:0043498 | cell surface binding | IDA | 17470632 | |
| GO:0043183 | vascular endothelial growth factor receptor 1 binding | IPI | 1312256 | |
| GO:0050840 | extracellular matrix binding | IC | 14570917 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 15351965 |
| GO:0001570 | vasculogenesis | TAS | 15015550 | |
| GO:0001525 | angiogenesis | IDA | 11427521 | |
| GO:0001666 | response to hypoxia | IDA | 16490744 | |
| GO:0002687 | positive regulation of leukocyte migration | TAS | 1312256 | |
| GO:0001938 | positive regulation of endothelial cell proliferation | IDA | 9202027 | |
| GO:0001938 | positive regulation of endothelial cell proliferation | ISS | - | |
| GO:0008283 | cell proliferation | IEA | - | |
| GO:0008360 | regulation of cell shape | IDA | 7929439 |10527820 | |
| GO:0048008 | platelet-derived growth factor receptor signaling pathway | IDA | 17470632 | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0043066 | negative regulation of apoptosis | IMP | 10066377 |11461089 | |
| GO:0050930 | induction of positive chemotaxis | NAS | 12744932 | |
| GO:0030949 | positive regulation of vascular endothelial growth factor receptor signaling pathway | IDA | 1312256 |7929439 | |
| GO:0043536 | positive regulation of blood vessel endothelial cell migration | IDA | 9202027 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | EXP | 9684805 | |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005578 | proteinaceous extracellular matrix | NAS | 14570917 | |
| GO:0005615 | extracellular space | IDA | 16490744 | |
| GO:0016020 | membrane | IEA | - | |
| GO:0009986 | cell surface | IDA | 17470632 | |
| GO:0031093 | platelet alpha granule lumen | EXP | 9684805 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ADAMTS1 | C3-C5 | KIAA1346 | METH1 | ADAM metallopeptidase with thrombospondin type 1 motif, 1 | ADAMTS1 interacts with VEGF165 | BIND | 12716911 |
| ADAMTS1 | C3-C5 | KIAA1346 | METH1 | ADAM metallopeptidase with thrombospondin type 1 motif, 1 | Affinity Capture-Western Co-purification Reconstituted Complex | BioGRID | 12716911 |
| CTGF | CCN2 | HCS24 | IGFBP8 | MGC102839 | NOV2 | connective tissue growth factor | - | HPRD,BioGRID | 11744618 |
| FGF5 | HBGF-5 | Smag-82 | fibroblast growth factor 5 | - | HPRD | 9323936 |
| FLT1 | FLT | VEGFR1 | fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) | VEGF165 interacts with Flt-1. This interaction was modeled on a demonstrated interaction between human VEGF165 and Flt-1 from an unspecified species. | BIND | 14600159 |
| FLT1 | FLT | VEGFR1 | fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) | VEGF-A interacts with VEGFR-1. This interaction was modeled on a demonstrated interaction between human VEGF-A and VEGFR-1 from an unspecified species. | BIND | 12810700 |
| FLT1 | FLT | VEGFR1 | fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) | - | HPRD | 8621427 |
| GPC1 | FLJ38078 | glypican | glypican 1 | - | HPRD,BioGRID | 10196157 |
| HIF1A | HIF-1alpha | HIF1 | HIF1-ALPHA | MOP1 | PASD8 | hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) | HIF1A (HIF-1-alpha) interacts with the VEGF promoter. | BIND | 15674338 |
| IGFBP7 | FSTL2 | IGFBP-7 | IGFBP-7v | IGFBPRP1 | MAC25 | PSF | insulin-like growth factor binding protein 7 | - | HPRD,BioGRID | 12407018 |
| KDR | CD309 | FLK1 | VEGFR | VEGFR2 | kinase insert domain receptor (a type III receptor tyrosine kinase) | VEGF-A interacts with VEGFR-2. This interaction was modeled on a demonstrated interaction between human VEGF-A and VEGFR-2 from an unspecified species. | BIND | 12810700 |
| KDR | CD309 | FLK1 | VEGFR | VEGFR2 | kinase insert domain receptor (a type III receptor tyrosine kinase) | VEGF165 interacts with KDR. This interaction was modeled on a demonstrated interaction between human VEGF165 and KDR from an unspecified species. | BIND | 14600159 |
| KDR | CD309 | FLK1 | VEGFR | VEGFR2 | kinase insert domain receptor (a type III receptor tyrosine kinase) | - | HPRD | 8621427 |
| KDR | CD309 | FLK1 | VEGFR | VEGFR2 | kinase insert domain receptor (a type III receptor tyrosine kinase) | VEGF interacts with KDR. | BIND | 15542434 |
| KDR | CD309 | FLK1 | VEGFR | VEGFR2 | kinase insert domain receptor (a type III receptor tyrosine kinase) | Biochemical Activity | BioGRID | 12716911 |
| NRP1 | BDCA4 | CD304 | DKFZp686A03134 | DKFZp781F1414 | NP1 | NRP | VEGF165R | neuropilin 1 | Affinity Capture-Western Reconstituted Complex | BioGRID | 9529250 |11986311 |
| NRP1 | BDCA4 | CD304 | DKFZp686A03134 | DKFZp781F1414 | NP1 | NRP | VEGF165R | neuropilin 1 | NRP1 interacts with VEGF165. | BIND | 11986311 |
| NRP1 | BDCA4 | CD304 | DKFZp686A03134 | DKFZp781F1414 | NP1 | NRP | VEGF165R | neuropilin 1 | - | HPRD | 9529250 |10409677 |11986311 |
| NRP1 | BDCA4 | CD304 | DKFZp686A03134 | DKFZp781F1414 | NP1 | NRP | VEGF165R | neuropilin 1 | VEGF165 interacts with neuropilin-1. This interaction was modeled on a demonstrated interaction between human VEGF165 and neuropilin-1 from an unspecified species. | BIND | 14600159 |
| NRP2 | MGC126574 | NP2 | NPN2 | PRO2714 | VEGF165R2 | neuropilin 2 | - | HPRD | 10748121 |
| NRP2 | MGC126574 | NP2 | NPN2 | PRO2714 | VEGF165R2 | neuropilin 2 | NP-2 interacts with VEGF145. | BIND | 10748121 |
| NRP2 | MGC126574 | NP2 | NPN2 | PRO2714 | VEGF165R2 | neuropilin 2 | NP-2 interacts with VEGF165. | BIND | 10748121 |
| PGF | D12S1900 | PGFL | PLGF | PlGF-2 | SHGC-10760 | placental growth factor | - | HPRD,BioGRID | 12086892 |12796773 |
| RB1 | OSRC | RB | p105-Rb | pRb | pp110 | retinoblastoma 1 | RB1 (pRB) interacts with the VEGF promoter. | BIND | 15674338 |
| SEMA3F | SEMA-IV | SEMA4 | SEMAK | sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F | - | HPRD | 12845630 |
| SPARC | ON | secreted protein, acidic, cysteine-rich (osteonectin) | - | HPRD,BioGRID | 9792673 |
| VEGFA | MGC70609 | VEGF | VEGF-A | VPF | vascular endothelial growth factor A | - | HPRD,BioGRID | 8631822 |9207067 |
| VTN | V75 | VN | VNT | vitronectin | - | HPRD,BioGRID | 11796824 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION | 267 | 161 | All SZGR 2.0 genes in this pathway |
| KEGG MTOR SIGNALING PATHWAY | 52 | 40 | All SZGR 2.0 genes in this pathway |
| KEGG VEGF SIGNALING PATHWAY | 76 | 53 | All SZGR 2.0 genes in this pathway |
| KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
| KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
| KEGG RENAL CELL CARCINOMA | 70 | 60 | All SZGR 2.0 genes in this pathway |
| KEGG PANCREATIC CANCER | 70 | 56 | All SZGR 2.0 genes in this pathway |
| KEGG BLADDER CANCER | 42 | 33 | All SZGR 2.0 genes in this pathway |
| BIOCARTA NO1 PATHWAY | 33 | 24 | All SZGR 2.0 genes in this pathway |
| BIOCARTA HIF PATHWAY | 15 | 12 | All SZGR 2.0 genes in this pathway |
| BIOCARTA VEGF PATHWAY | 29 | 18 | All SZGR 2.0 genes in this pathway |
| PID INTEGRIN1 PATHWAY | 66 | 44 | All SZGR 2.0 genes in this pathway |
| PID GLYPICAN 1PATHWAY | 27 | 20 | All SZGR 2.0 genes in this pathway |
| PID HIF2PATHWAY | 34 | 29 | All SZGR 2.0 genes in this pathway |
| PID INTEGRIN3 PATHWAY | 43 | 25 | All SZGR 2.0 genes in this pathway |
| PID S1P S1P3 PATHWAY | 29 | 24 | All SZGR 2.0 genes in this pathway |
| PID TCPTP PATHWAY | 43 | 33 | All SZGR 2.0 genes in this pathway |
| PID SHP2 PATHWAY | 58 | 46 | All SZGR 2.0 genes in this pathway |
| PID S1P S1P1 PATHWAY | 21 | 18 | All SZGR 2.0 genes in this pathway |
| PID INTEGRIN A9B1 PATHWAY | 25 | 18 | All SZGR 2.0 genes in this pathway |
| PID VEGF VEGFR PATHWAY | 10 | 6 | All SZGR 2.0 genes in this pathway |
| PID AVB3 INTEGRIN PATHWAY | 75 | 53 | All SZGR 2.0 genes in this pathway |
| PID VEGFR1 PATHWAY | 26 | 23 | All SZGR 2.0 genes in this pathway |
| PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
| PID HIF1 TFPATHWAY | 66 | 52 | All SZGR 2.0 genes in this pathway |
| REACTOME REGULATION OF HYPOXIA INDUCIBLE FACTOR HIF BY OXYGEN | 25 | 17 | All SZGR 2.0 genes in this pathway |
| REACTOME VEGF LIGAND RECEPTOR INTERACTIONS | 10 | 6 | All SZGR 2.0 genes in this pathway |
| REACTOME RESPONSE TO ELEVATED PLATELET CYTOSOLIC CA2 | 89 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
| REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION | 208 | 138 | All SZGR 2.0 genes in this pathway |
| WINTER HYPOXIA UP | 92 | 57 | All SZGR 2.0 genes in this pathway |
| PARENT MTOR SIGNALING DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
| KOBAYASHI EGFR SIGNALING 6HR DN | 18 | 13 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
| PRAMOONJAGO SOX4 TARGETS UP | 52 | 38 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
| RODRIGUES NTN1 TARGETS DN | 158 | 102 | All SZGR 2.0 genes in this pathway |
| SMIRNOV CIRCULATING ENDOTHELIOCYTES IN CANCER UP | 158 | 103 | All SZGR 2.0 genes in this pathway |
| GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS RED UP | 17 | 13 | All SZGR 2.0 genes in this pathway |
| PEPPER CHRONIC LYMPHOCYTIC LEUKEMIA UP | 33 | 28 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HYPOXIA UP | 171 | 112 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HYPOXIA BY DMOG UP | 130 | 85 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HIF1A AND HIF2A TARGETS DN | 104 | 72 | All SZGR 2.0 genes in this pathway |
| PACHER TARGETS OF IGF1 AND IGF2 UP | 35 | 27 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN | 234 | 147 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION DN | 84 | 54 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 4 5WK DN | 196 | 131 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL TGFB1 TARGETS UP | 169 | 127 | All SZGR 2.0 genes in this pathway |
| BEGUM TARGETS OF PAX3 FOXO1 FUSION DN | 45 | 34 | All SZGR 2.0 genes in this pathway |
| MARKS HDAC TARGETS DN | 15 | 11 | All SZGR 2.0 genes in this pathway |
| BAKER HEMATOPOIESIS STAT3 TARGETS | 16 | 12 | All SZGR 2.0 genes in this pathway |
| RASHI RESPONSE TO IONIZING RADIATION 1 | 45 | 27 | All SZGR 2.0 genes in this pathway |
| LI AMPLIFIED IN LUNG CANCER | 178 | 108 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| AGARWAL AKT PATHWAY TARGETS | 10 | 9 | All SZGR 2.0 genes in this pathway |
| AMUNDSON RESPONSE TO ARSENITE | 217 | 143 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM UP | 176 | 111 | All SZGR 2.0 genes in this pathway |
| OXFORD RALA OR RALB TARGETS DN | 24 | 17 | All SZGR 2.0 genes in this pathway |
| MAINA VHL TARGETS DN | 18 | 14 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 2 DN | 51 | 42 | All SZGR 2.0 genes in this pathway |
| SIMBULAN UV RESPONSE NORMAL DN | 33 | 27 | All SZGR 2.0 genes in this pathway |
| HASINA NOL7 TARGETS DN | 13 | 9 | All SZGR 2.0 genes in this pathway |
| KONDO HYPOXIA | 8 | 6 | All SZGR 2.0 genes in this pathway |
| GROSS HYPOXIA VIA ELK3 DN | 156 | 106 | All SZGR 2.0 genes in this pathway |
| GROSS HYPOXIA VIA HIF1A DN | 110 | 78 | All SZGR 2.0 genes in this pathway |
| GROSS HYPOXIA VIA ELK3 AND HIF1A UP | 142 | 104 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| MANTOVANI NFKB TARGETS UP | 43 | 33 | All SZGR 2.0 genes in this pathway |
| MANTOVANI VIRAL GPCR SIGNALING UP | 86 | 54 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| LOCKWOOD AMPLIFIED IN LUNG CANCER | 214 | 139 | All SZGR 2.0 genes in this pathway |
| CAFFAREL RESPONSE TO THC UP | 33 | 20 | All SZGR 2.0 genes in this pathway |
| RANKIN ANGIOGENIC TARGETS OF VHL HIF2A DN | 8 | 7 | All SZGR 2.0 genes in this pathway |
| HE PTEN TARGETS DN | 7 | 6 | All SZGR 2.0 genes in this pathway |
| AMIT EGF RESPONSE 60 HELA | 46 | 32 | All SZGR 2.0 genes in this pathway |
| AMIT EGF RESPONSE 480 MCF10A | 43 | 26 | All SZGR 2.0 genes in this pathway |
| SHIPP DLBCL CURED VS FATAL DN | 45 | 30 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER METASTASIS DN | 121 | 65 | All SZGR 2.0 genes in this pathway |
| TENEDINI MEGAKARYOCYTE MARKERS | 66 | 48 | All SZGR 2.0 genes in this pathway |
| MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| KLEIN PRIMARY EFFUSION LYMPHOMA UP | 51 | 29 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
| SCHURINGA STAT5A TARGETS UP | 21 | 13 | All SZGR 2.0 genes in this pathway |
| GALINDO IMMUNE RESPONSE TO ENTEROTOXIN | 85 | 67 | All SZGR 2.0 genes in this pathway |
| GUO HEX TARGETS UP | 81 | 54 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND UP | 77 | 52 | All SZGR 2.0 genes in this pathway |
| JAIN NFKB SIGNALING | 75 | 44 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
| ALCALAY AML BY NPM1 LOCALIZATION DN | 184 | 132 | All SZGR 2.0 genes in this pathway |
| MENSE HYPOXIA UP | 98 | 71 | All SZGR 2.0 genes in this pathway |
| VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
| SESTO RESPONSE TO UV C8 | 72 | 56 | All SZGR 2.0 genes in this pathway |
| KIM HYPOXIA | 25 | 21 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| HARRIS HYPOXIA | 81 | 64 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
| YAMAZAKI TCEB3 TARGETS UP | 175 | 116 | All SZGR 2.0 genes in this pathway |
| LEONARD HYPOXIA | 47 | 35 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
| GENTILE UV RESPONSE CLUSTER D2 | 41 | 30 | All SZGR 2.0 genes in this pathway |
| LEE AGING NEOCORTEX UP | 89 | 59 | All SZGR 2.0 genes in this pathway |
| GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS PEAK AT 2HR | 51 | 36 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS 1 | 33 | 24 | All SZGR 2.0 genes in this pathway |
| BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
| SEMENZA HIF1 TARGETS | 36 | 32 | All SZGR 2.0 genes in this pathway |
| SASSON FSH RESPONSE | 9 | 6 | All SZGR 2.0 genes in this pathway |
| TRACEY RESISTANCE TO IFNA2 DN | 32 | 23 | All SZGR 2.0 genes in this pathway |
| GERHOLD ADIPOGENESIS UP | 49 | 40 | All SZGR 2.0 genes in this pathway |
| BILD HRAS ONCOGENIC SIGNATURE | 261 | 166 | All SZGR 2.0 genes in this pathway |
| KRIGE AMINO ACID DEPRIVATION | 29 | 20 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
| COATES MACROPHAGE M1 VS M2 DN | 78 | 44 | All SZGR 2.0 genes in this pathway |
| MARZEC IL2 SIGNALING UP | 115 | 80 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
| IZADPANAH STEM CELL ADIPOSE VS BONE UP | 126 | 92 | All SZGR 2.0 genes in this pathway |
| GRADE COLON AND RECTAL CANCER UP | 285 | 167 | All SZGR 2.0 genes in this pathway |
| PODAR RESPONSE TO ADAPHOSTIN UP | 147 | 98 | All SZGR 2.0 genes in this pathway |
| LU TUMOR ANGIOGENESIS UP | 25 | 22 | All SZGR 2.0 genes in this pathway |
| CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
| QI PLASMACYTOMA DN | 100 | 63 | All SZGR 2.0 genes in this pathway |
| WINTER HYPOXIA METAGENE | 242 | 168 | All SZGR 2.0 genes in this pathway |
| TSAI RESPONSE TO RADIATION THERAPY | 32 | 20 | All SZGR 2.0 genes in this pathway |
| VART KSHV INFECTION ANGIOGENIC MARKERS UP | 165 | 118 | All SZGR 2.0 genes in this pathway |
| VART KSHV INFECTION ANGIOGENIC MARKERS DN | 138 | 92 | All SZGR 2.0 genes in this pathway |
| MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
| GU PDEF TARGETS UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
| MIZUKAMI HYPOXIA UP | 12 | 12 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
| HINATA NFKB TARGETS KERATINOCYTE UP | 91 | 63 | All SZGR 2.0 genes in this pathway |
| HINATA NFKB TARGETS FIBROBLAST UP | 84 | 60 | All SZGR 2.0 genes in this pathway |
| SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
| SHAFFER IRF4 TARGETS IN PLASMA CELL VS MATURE B LYMPHOCYTE | 67 | 51 | All SZGR 2.0 genes in this pathway |
| SHAFFER IRF4 TARGETS IN ACTIVATED B LYMPHOCYTE | 81 | 66 | All SZGR 2.0 genes in this pathway |
| VALK AML CLUSTER 11 | 36 | 24 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
| DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
| CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 5 | 30 | 22 | All SZGR 2.0 genes in this pathway |
| WU APOPTOSIS BY CDKN1A VIA TP53 | 55 | 31 | All SZGR 2.0 genes in this pathway |
| BAE BRCA1 TARGETS UP | 75 | 47 | All SZGR 2.0 genes in this pathway |
| HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP | 242 | 159 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP | 397 | 206 | All SZGR 2.0 genes in this pathway |
| QI HYPOXIA | 140 | 96 | All SZGR 2.0 genes in this pathway |
| CARD MIR302A TARGETS | 77 | 62 | All SZGR 2.0 genes in this pathway |
| KANG AR TARGETS DN | 19 | 12 | All SZGR 2.0 genes in this pathway |
| ZHU SKIL TARGETS UP | 20 | 14 | All SZGR 2.0 genes in this pathway |
| VANDESLUIS COMMD1 TARGETS GROUP 2 UP | 15 | 12 | All SZGR 2.0 genes in this pathway |
| DELPUECH FOXO3 TARGETS DN | 41 | 27 | All SZGR 2.0 genes in this pathway |
| KASLER HDAC7 TARGETS 2 DN | 32 | 23 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| FARDIN HYPOXIA 9 | 7 | 6 | All SZGR 2.0 genes in this pathway |
| FARDIN HYPOXIA 11 | 32 | 29 | All SZGR 2.0 genes in this pathway |
| WACKER HYPOXIA TARGETS OF VHL | 13 | 11 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
| DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
| NABA SECRETED FACTORS | 344 | 197 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 1445 | 1451 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| miR-134 | 1363 | 1369 | m8 | hsa-miR-134brain | UGUGACUGGUUGACCAGAGGG |
| miR-139 | 263 | 269 | 1A | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
| miR-140 | 997 | 1003 | m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
| miR-15/16/195/424/497 | 211 | 218 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-150 | 434 | 440 | m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
| miR-17-5p/20/93.mr/106/519.d | 112 | 118 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
| hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
| hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
| hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
| hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
| hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
| miR-185 | 1635 | 1641 | m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
| hsa-miR-185brain | UGGAGAGAAAGGCAGUUC | ||||
| miR-186 | 360 | 366 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-199 | 402 | 408 | 1A | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
| miR-200bc/429 | 1233 | 1239 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-205 | 85 | 92 | 1A,m8 | hsa-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
| miR-29 | 1677 | 1684 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-299-3p | 278 | 285 | 1A,m8 | hsa-miR-299-3p | UAUGUGGGAUGGUAAACCGCUU |
| miR-34/449 | 778 | 784 | m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
| miR-342 | 1038 | 1044 | m8 | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
| miR-34b | 779 | 785 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
| miR-361 | 1553 | 1560 | 1A,m8 | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC |
| miR-377 | 1037 | 1043 | m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
| miR-383 | 1849 | 1855 | m8 | hsa-miR-383brain | AGAUCAGAAGGUGAUUGUGGCU |
| miR-410 | 339 | 345 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| hsa-miR-410 | AAUAUAACACAGAUGGCCUGU | ||||
| miR-495 | 1658 | 1664 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| miR-496 | 1588 | 1594 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-503 | 212 | 218 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
| miR-543 | 385 | 391 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
| miR-93.hd/291-3p/294/295/302/372/373/520 | 111 | 117 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
| hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
| hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
| hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
| hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
| hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
| hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
| hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
| hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
| hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
| hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
| hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.