SZGR2

Summary ?

GeneID	7482
Symbol	WNT2B
Synonyms	WNT13
Description	wingless-type MMTV integration site family member 2B
Reference	MIM:601968\|HGNC:HGNC:12781\|Ensembl:ENSG00000134245\|HPRD:03574\|Vega:OTTHUMG00000011157
Gene type	protein-coding
Map location	1p13
Pascal p-value	2.915E-4
Fetal beta	0.721
DMG	1 (# studies)
eGene	Cortex Frontal Cortex BA9 Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.0235
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg19722720	1	113051353	WNT2B	3.13E-5	-0.34	0.019	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ELOVL2	0.79	0.79
ADAM17	0.79	0.75
UGDH	0.79	0.74
ARFIP1	0.78	0.74
EPB41L5	0.78	0.81
RP2	0.78	0.76
FSTL1	0.78	0.76
RDX	0.77	0.74
PGGT1B	0.77	0.73
PKN2	0.77	0.76

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CA4	-0.48	-0.48
MYL3	-0.47	-0.48
IFI27	-0.44	-0.49
AF347015.21	-0.44	-0.47
C2orf82	-0.43	-0.55
FXYD1	-0.43	-0.46
AC018755.7	-0.43	-0.49
MT-CO2	-0.43	-0.48
CXCL14	-0.43	-0.47
CA11	-0.42	-0.46

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004871	signal transducer activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007223	Wnt receptor signaling pathway, calcium modulating pathway	IEA		-
GO:0009653	anatomical structure morphogenesis	TAS		8761309
GO:0007275	multicellular organismal development	TAS		8761309
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005578	proteinaceous extracellular matrix	IEA		-
GO:0005615	extracellular space	TAS		8761309

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG HEDGEHOG SIGNALING PATHWAY	56	42	All SZGR 2.0 genes in this pathway
KEGG MELANOGENESIS	102	80	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA	55	44	All SZGR 2.0 genes in this pathway
WNT SIGNALING	89	71	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS	88	58	All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING	408	246	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
VERRECCHIA RESPONSE TO TGFB1 C2	25	18	All SZGR 2.0 genes in this pathway
VERRECCHIA EARLY RESPONSE TO TGFB1	58	43	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER RACE UP	299	167	All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1	91	75	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS UP	165	118	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN	138	92	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K27ME3	269	159	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS	344	197	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-130/301	281	288	1A,m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-15/16/195/424/497	96	102	1A	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-218	49	56	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-503	96	102	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: WNT2B