SZGR2

Summary ?

GeneID	7555
Symbol	CNBP
Synonyms	CNBP1\|DM2\|PROMM\|RNF163\|ZCCHC22\|ZNF9
Description	CCHC-type zinc finger, nucleic acid binding protein
Reference	MIM:116955\|HGNC:HGNC:13164\|HPRD:00311\|
Gene type	protein-coding
Map location	3q21
Pascal p-value	0.009
Sherlock p-value	0.201

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0324

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003676	nucleic acid binding	IEA		-
GO:0003700	transcription factor activity	TAS		2562787
GO:0005515	protein binding	IPI		17353931
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	TAS		2562787
GO:0006350	transcription	IEA		-
GO:0006695	cholesterol biosynthetic process	TAS		2562787
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	IEA		-
GO:0005783	endoplasmic reticulum	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APOBEC3C	APOBEC1L \| ARDC2 \| ARDC4 \| ARP5 \| MGC19485 \| PBI \| bK150C2.3	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C	Affinity Capture-MS	BioGRID	17353931
BXDC2	BRIX \| FLJ11100	brix domain containing 2	Affinity Capture-MS	BioGRID	17353931
DAP3	DAP-3 \| DKFZp686G12159 \| MGC126058 \| MGC126059 \| MRP-S29 \| MRPS29 \| bMRP-10	death associated protein 3	Affinity Capture-MS	BioGRID	17353931
DHX9	DDX9 \| LKP \| NDHII \| RHA	DEAH (Asp-Glu-Ala-His) box polypeptide 9	Affinity Capture-MS	BioGRID	17353931
EBNA1BP2	EBP2 \| NOBP \| P40	EBNA1 binding protein 2	Affinity Capture-MS	BioGRID	17353931
ERH	DROER \| FLJ27340	enhancer of rudimentary homolog (Drosophila)	Affinity Capture-MS	BioGRID	17353931
HNRNPA3	2610510D13Rik \| D10S102 \| FBRNP \| HNRPA3 \| MGC138232 \| MGC142030	heterogeneous nuclear ribonucleoprotein A3	Affinity Capture-MS	BioGRID	17353931
HNRNPAB	ABBP1 \| FLJ40338 \| HNRPAB	heterogeneous nuclear ribonucleoprotein A/B	Affinity Capture-MS	BioGRID	17353931
HNRNPC	C1 \| C2 \| HNRNP \| HNRPC \| MGC104306 \| MGC105117 \| MGC117353 \| MGC131677 \| SNRPC	heterogeneous nuclear ribonucleoprotein C (C1/C2)	Affinity Capture-MS	BioGRID	17353931
HNRNPR	FLJ25714 \| HNRPR \| hnRNP-R	heterogeneous nuclear ribonucleoprotein R	Affinity Capture-MS	BioGRID	17353931
HNRNPUL1	E1B-AP5 \| E1BAP5 \| FLJ12944 \| HNRPUL1	heterogeneous nuclear ribonucleoprotein U-like 1	Affinity Capture-MS	BioGRID	17353931
IGF2BP1	CRD-BP \| CRDBP \| IMP-1 \| IMP1 \| VICKZ1 \| ZBP1	insulin-like growth factor 2 mRNA binding protein 1	Affinity Capture-MS	BioGRID	17353931
IGF2BP3	DKFZp686F1078 \| IMP-3 \| IMP3 \| KOC1 \| VICKZ3	insulin-like growth factor 2 mRNA binding protein 3	Affinity Capture-MS	BioGRID	17353931
PURA	PUR-ALPHA \| PUR1 \| PURALPHA	purine-rich element binding protein A	Affinity Capture-MS	BioGRID	17353931
RBMX	HNRPG \| RBMXP1 \| RBMXRT \| RNMX \| hnRNP-G	RNA binding motif protein, X-linked	Affinity Capture-MS	BioGRID	17353931
RPA3	REPA3	replication protein A3, 14kDa	Affinity Capture-MS	BioGRID	17353931
RPL23A	FLJ27455 \| MDA20	ribosomal protein L23a	Affinity Capture-MS	BioGRID	17353931
RPL3	MGC104284 \| TARBP-B	ribosomal protein L3	Affinity Capture-MS	BioGRID	17353931
RPL31	MGC88191	ribosomal protein L31	Affinity Capture-MS	BioGRID	17353931
RPL34	MGC111005	ribosomal protein L34	Affinity Capture-MS	BioGRID	17353931
RPL35A	-	ribosomal protein L35a	Affinity Capture-MS	BioGRID	17353931
RPL36	DKFZp566B023	ribosomal protein L36	Affinity Capture-MS	BioGRID	17353931
RPS16	-	ribosomal protein S16	Affinity Capture-MS	BioGRID	17353931
RPS19	DBA	ribosomal protein S19	Affinity Capture-MS	BioGRID	17353931
RPS3A	FTE1 \| MFTL \| MGC23240	ribosomal protein S3A	Affinity Capture-MS	BioGRID	17353931
RSL1D1	CSIG \| DKFZP564M182 \| L12 \| MGC138433 \| MGC142259 \| PBK1	ribosomal L1 domain containing 1	Affinity Capture-MS	BioGRID	17353931
SYNCRIP	GRY-RBP \| HNRPQ1 \| NSAP1 \| RP1-3J17.2 \| dJ3J17.2 \| hnRNP-Q \| pp68	synaptotagmin binding, cytoplasmic RNA interacting protein	Affinity Capture-MS	BioGRID	17353931

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
RHEIN ALL GLUCOCORTICOID THERAPY DN	362	238	All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS REPRESSED BY SERUM	159	93	All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE NORMAL DN	33	27	All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP	390	236	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC 24HR 5 UP	34	23	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
IIZUKA LIVER CANCER PROGRESSION L0 L1 UP	17	12	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS	185	114	All SZGR 2.0 genes in this pathway
ZUCCHI METASTASIS UP	43	24	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
PARK HSC AND MULTIPOTENT PROGENITORS	50	33	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C0	107	72	All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER UP	285	167	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS DN	210	128	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
BAE BRCA1 TARGETS UP	75	47	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN	841	431	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP	682	440	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-129-5p	174	180	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	174	180	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-193	102	108	m8	hsa-miR-193a	AACUGGCCUACAAAGUCCCAG
miR-193	102	108	m8	hsa-miR-193b	AACUGGCCCUCAAAGUCCCGCUUU
miR-320	110	116	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-326	643	649	m8	hsa-miR-326	CCUCUGGGCCCUUCCUCCAG
miR-330	217	223	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-369-3p	42	48	m8	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-378	689	695	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-381	737	743	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-494	764	770	1A	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-495	220	226	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CNBP