SZGR2

Summary ?

GeneID	7559
Symbol	ZNF12
Synonyms	GIOT-3\|HZF11\|KOX3\|ZNF325
Description	zinc finger protein 12
Reference	MIM:194536\|HGNC:HGNC:12902\|Ensembl:ENSG00000164631\|HPRD:11835\|HPRD:15773\|Vega:OTTHUMG00000151910
Gene type	protein-coding
Map location	7p22.1
Pascal p-value	0.004
Sherlock p-value	0.401
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
Expression	Meta-analysis of gene expression	P value: 1.595

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs16829545	chr2	151977407	ZNF12	7559	0	trans
rs12509866	chr4	173017639	ZNF12	7559	0.11	trans
rs7076439	chr10	93286841	ZNF12	7559	0.09	trans
rs11186601	chr10	93287199	ZNF12	7559	0.19	trans
rs16955618	chr15	29937543	ZNF12	7559	3.03E-4	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003676	nucleic acid binding	IEA		-
GO:0003677	DNA binding	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME GENERIC TRANSCRIPTION PATHWAY	352	181	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP	380	215	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
BILD SRC ONCOGENIC SIGNATURE	62	38	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-26	1884	1890	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	1884	1890	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-346	1110	1117	1A,m8	hsa-miR-346^brain	UGUCUGCCCGCAUGCCUGCCUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ZNF12