Gene Page: DDR1
Summary ?
GeneID | 780 |
Symbol | DDR1 |
Synonyms | CAK|CD167|DDR|EDDR1|HGK2|MCK10|NEP|NTRK4|PTK3|PTK3A|RTK6|TRKE |
Description | discoidin domain receptor tyrosine kinase 1 |
Reference | MIM:600408|HGNC:HGNC:2730|Ensembl:ENSG00000204580|HPRD:02678|Vega:OTTHUMG00000031236 |
Gene type | protein-coding |
Map location | 6p21.3 |
Pascal p-value | 1.847E-13 |
Sherlock p-value | 0.166 |
Fetal beta | 0.826 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Montano_2016 | Genome-wide DNA methylation analysis | This dataset includes 172 replicated associations between CpGs with schizophrenia. | 4 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
Expression | Meta-analysis of gene expression | P value: 2.35 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0973 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg16111190 | 6 | 30860887 | DDR1 | 3.78E-5 | 0.011 | 0.084 | DMG:Montano_2016 |
cg19148201 | 6 | 30860237 | DDR1 | 5.09E-5 | 0.011 | 0.098 | DMG:Montano_2016 |
cg17879299 | 6 | 30860300 | DDR1 | 9.97E-5 | 0.015 | 0.12 | DMG:Montano_2016 |
cg07979747 | 6 | 30860136 | DDR1 | 2.31E-4 | 0.007 | 0.164 | DMG:Montano_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6879593 | chr5 | 75253310 | DDR1 | 780 | 0.19 | trans | ||
rs10126993 | chrX | 35885796 | DDR1 | 780 | 0.08 | trans | ||
rs4501739 | chrX | 35960848 | DDR1 | 780 | 0 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AGAP3 | 0.90 | 0.89 |
GSK3A | 0.89 | 0.89 |
TBC1D25 | 0.89 | 0.89 |
STK25 | 0.88 | 0.86 |
NUMBL | 0.88 | 0.89 |
FAM160A2 | 0.88 | 0.88 |
DTX3 | 0.87 | 0.87 |
EPN1 | 0.87 | 0.86 |
ZMIZ2 | 0.87 | 0.90 |
BRSK2 | 0.86 | 0.86 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.78 | -0.72 |
AF347015.8 | -0.76 | -0.72 |
AF347015.31 | -0.76 | -0.71 |
AF347015.21 | -0.76 | -0.76 |
MT-CYB | -0.75 | -0.70 |
AF347015.33 | -0.75 | -0.70 |
AF347015.26 | -0.75 | -0.69 |
AF347015.27 | -0.74 | -0.73 |
AF347015.15 | -0.72 | -0.69 |
AL139819.3 | -0.72 | -0.73 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004714 | transmembrane receptor protein tyrosine kinase activity | TAS | neurite (GO term level: 8) | 9659899 |
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004872 | receptor activity | IEA | - | |
GO:0005515 | protein binding | IPI | 17721511 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004713 | protein tyrosine kinase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007169 | transmembrane receptor protein tyrosine kinase signaling pathway | IEA | - | |
GO:0007155 | cell adhesion | TAS | 8302582 | |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 8390675 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
COL11A1 | CO11A1 | COLL6 | STL2 | collagen, type XI, alpha 1 | - | HPRD | 9659900 |
COL2A1 | ANFH | AOM | COL11A3 | MGC131516 | SEDC | collagen, type II, alpha 1 | - | HPRD | 9659900 |
COL3A1 | EDS4A | FLJ34534 | collagen, type III, alpha 1 | - | HPRD | 9659900 |
COL5A2 | MGC105115 | collagen, type V, alpha 2 | - | HPRD | 9659900 |
DDR1 | CAK | CD167 | DDR | EDDR1 | MCK10 | NEP | NTRK4 | PTK3 | PTK3A | RTK6 | TRKE | discoidin domain receptor tyrosine kinase 1 | The DDR1 receptor tyrosine kinase autophosphorylates | BIND | 9659899 |
FRS2 | FRS2A | FRS2alpha | SNT | SNT-1 | SNT1 | fibroblast growth factor receptor substrate 2 | - | HPRD | 10783152 |
PLCG1 | PLC-II | PLC1 | PLC148 | PLCgamma1 | phospholipase C, gamma 1 | - | HPRD | 10783152 |
RGS2 | G0S8 | regulator of G-protein signaling 2, 24kDa | Two-hybrid | BioGRID | 16169070 |
SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | - | HPRD | 10783152 |
SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | DDR1 interacts with Shc. | BIND | 9659899 |10681566 |
SNAPIN | SNAPAP | SNAP-associated protein | Two-hybrid | BioGRID | 16169070 |
SNRNP40 | 40K | FLJ41108 | HPRP8BP | MGC1910 | PRP8BP | PRPF8BP | RP11-490K7.3 | SPF38 | WDR57 | small nuclear ribonucleoprotein 40kDa (U5) | Two-hybrid | BioGRID | 16169070 |
TM4SF1 | H-L6 | L6 | M3S1 | TAAL6 | transmembrane 4 L six family member 1 | Two-hybrid | BioGRID | 16169070 |
TTR | HsT2651 | PALB | TBPA | transthyretin | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE UP | 108 | 67 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP | 368 | 234 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
BOGNI TREATMENT RELATED MYELOID LEUKEMIA DN | 33 | 19 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP | 185 | 126 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP | 204 | 140 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION ERYTHROCYTE UP | 157 | 104 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION SUSTAINDED IN ERYTHROCYTE UP | 44 | 30 | All SZGR 2.0 genes in this pathway |
UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA UP | 171 | 112 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS CDC25 DN | 51 | 35 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN | 142 | 95 | All SZGR 2.0 genes in this pathway |
CREIGHTON AKT1 SIGNALING VIA MTOR UP | 34 | 22 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 4 5WK UP | 271 | 175 | All SZGR 2.0 genes in this pathway |
LUI THYROID CANCER PAX8 PPARG UP | 44 | 29 | All SZGR 2.0 genes in this pathway |
PATTERSON DOCETAXEL RESISTANCE | 29 | 20 | All SZGR 2.0 genes in this pathway |
BORLAK LIVER CANCER EGF UP | 57 | 41 | All SZGR 2.0 genes in this pathway |
SASAI RESISTANCE TO NEOPLASTIC TRANSFROMATION | 50 | 31 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM2 | 153 | 102 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM3 | 70 | 37 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
SANA TNF SIGNALING DN | 90 | 57 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
MAGRANGEAS MULTIPLE MYELOMA IGLL VS IGLK UP | 42 | 24 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
MOREAUX B LYMPHOCYTE MATURATION BY TACI UP | 92 | 58 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
KAYO CALORIE RESTRICTION MUSCLE DN | 87 | 59 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
HU GENOTOXIC DAMAGE 24HR | 35 | 22 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
VERRECCHIA RESPONSE TO TGFB1 C5 | 21 | 11 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
DELLA RESPONSE TO TSA AND BUTYRATE | 21 | 17 | All SZGR 2.0 genes in this pathway |
VERRECCHIA DELAYED RESPONSE TO TGFB1 | 39 | 26 | All SZGR 2.0 genes in this pathway |
SAFFORD T LYMPHOCYTE ANERGY | 87 | 54 | All SZGR 2.0 genes in this pathway |
LEE METASTASIS AND ALTERNATIVE SPLICING UP | 74 | 51 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
OUILLETTE CLL 13Q14 DELETION DN | 60 | 38 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
VILIMAS NOTCH1 TARGETS UP | 52 | 41 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
DING LUNG CANCER BY MUTATION RATE | 20 | 18 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G1 UP | 113 | 70 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS PROLIFERATION UP | 178 | 108 | All SZGR 2.0 genes in this pathway |
COULOUARN TEMPORAL TGFB1 SIGNATURE UP | 109 | 68 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SURVIVAL UP | 73 | 49 | All SZGR 2.0 genes in this pathway |
YAMASHITA LIVER CANCER STEM CELL UP | 47 | 38 | All SZGR 2.0 genes in this pathway |
WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
YAMANAKA GLIOBLASTOMA SURVIVAL DN | 9 | 7 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF LCP WITH H3K4ME3 | 128 | 68 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES LCP WITH H3K4ME3 | 142 | 80 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC LCP WITH H3K4ME3 | 58 | 34 | All SZGR 2.0 genes in this pathway |
OHGUCHI LIVER HNF4A TARGETS UP | 44 | 30 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
PECE MAMMARY STEM CELL UP | 146 | 75 | All SZGR 2.0 genes in this pathway |
SMIRNOV RESPONSE TO IR 6HR UP | 166 | 97 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-199 | 416 | 423 | 1A,m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC | ||||
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC | ||||
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.