Gene Page: THTPA
Summary ?
| GeneID | 79178 |
| Symbol | THTPA |
| Synonyms | THTP|THTPASE |
| Description | thiamine triphosphatase |
| Reference | MIM:611612|HGNC:HGNC:18987|Ensembl:ENSG00000259431|HPRD:15505|Vega:OTTHUMG00000172558 |
| Gene type | protein-coding |
| Map location | 14q11.2 |
| Pascal p-value | 0.579 |
| Fetal beta | -0.618 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.047 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg03516708 | 14 | 24024880 | THTPA | 1.38E-9 | -0.027 | 1.37E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004016 | adenylate cyclase activity | IEA | - | |
| GO:0050333 | thiamin-triphosphatase activity | IDA | 11827967 | |
| GO:0016787 | hydrolase activity | TAS | 11827967 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006171 | cAMP biosynthetic process | IEA | - | |
| GO:0006091 | generation of precursor metabolites and energy | NAS | 11827967 | |
| GO:0006772 | thiamin metabolic process | TAS | 11827967 | |
| GO:0016311 | dephosphorylation | IDA | 11827967 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005625 | soluble fraction | NAS | 11827967 | |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME METABOLISM OF VITAMINS AND COFACTORS | 51 | 36 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA NEURAL | 129 | 85 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-218 | 292 | 298 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-31 | 308 | 314 | 1A | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
| miR-485-5p | 232 | 238 | m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.