SZGR2

Summary ?

GeneID	79712
Symbol	GTDC1
Synonyms	Hmat-Xa\|mat-Xa
Description	glycosyltransferase like domain containing 1
Reference	MIM:610165\|HGNC:HGNC:20887\|Ensembl:ENSG00000121964\|HPRD:13615\|Vega:OTTHUMG00000131835
Gene type	protein-coding
Map location	2q22.3
Pascal p-value	0.006
Sherlock p-value	0.63
Fetal beta	-0.013

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.023
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.02395

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
GDA	0.73	0.60
MYRIP	0.71	0.60
PTPRR	0.70	0.62
TRHDE	0.70	0.60
RP4-788L13.1	0.70	0.57
DLGAP2	0.70	0.60
CLOCK	0.69	0.56
NETO1	0.69	0.65
GRIN2A	0.69	0.55
GLRA3	0.68	0.55

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NUDT8	-0.36	-0.37
BCL7C	-0.33	-0.36
EMX2	-0.32	-0.41
NT5C	-0.31	-0.31
ACP6	-0.31	-0.30
GRTP1	-0.31	-0.31
MUTYH	-0.30	-0.32
AC132872.1	-0.30	-0.33
IMPA2	-0.30	-0.35
RDH5	-0.30	-0.22

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016757	transferase activity, transferring glycosyl groups	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0009058	biosynthetic process	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
THUM SYSTOLIC HEART FAILURE UP	423	283	All SZGR 2.0 genes in this pathway
GRABARCZYK BCL11B TARGETS DN	57	35	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP	372	227	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 DN	242	165	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
XU HGF TARGETS REPRESSED BY AKT1 DN	95	58	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING UP	93	62	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-129-5p	274	280	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	274	280	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-132/212	267	273	m8	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	267	273	m8	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-186	390	396	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-381	294	300	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-383	75	81	1A	hsa-miR-383^brain	AGAUCAGAAGGUGAUUGUGGCU
miR-490	470	477	1A,m8	hsa-miR-490	CAACCUGGAGGACUCCAUGCUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GTDC1