Gene Page: TTLL7
Summary ?
| GeneID | 79739 |
| Symbol | TTLL7 |
| Synonyms | - |
| Description | tubulin tyrosine ligase like 7 |
| Reference | HGNC:HGNC:26242|Ensembl:ENSG00000137941|HPRD:08013| |
| Gene type | protein-coding |
| Map location | 1p31.1 |
| Pascal p-value | 0.013 |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 | |
| Expression | Meta-analysis of gene expression | P value: 1.656 | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| GPS1 | 0.92 | 0.92 |
| MRPS2 | 0.90 | 0.92 |
| MAP2K2 | 0.89 | 0.90 |
| LYPLA2 | 0.88 | 0.88 |
| TBRG4 | 0.88 | 0.85 |
| PPP2R1A | 0.88 | 0.88 |
| GNB1L | 0.88 | 0.86 |
| THAP8 | 0.87 | 0.87 |
| NOC4L | 0.87 | 0.88 |
| RUVBL2 | 0.87 | 0.87 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.8 | -0.67 | -0.73 |
| AF347015.33 | -0.66 | -0.72 |
| AF347015.27 | -0.66 | -0.72 |
| MT-CO2 | -0.65 | -0.69 |
| AF347015.31 | -0.65 | -0.69 |
| MT-CYB | -0.65 | -0.71 |
| AF347015.15 | -0.63 | -0.69 |
| AF347015.2 | -0.62 | -0.69 |
| AF347015.21 | -0.62 | -0.71 |
| AF347015.26 | -0.61 | -0.69 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004835 | tubulin-tyrosine ligase activity | IEA | - | |
| GO:0016874 | ligase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
| GO:0006464 | protein modification process | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0030154 | cell differentiation | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005929 | cilium | IEA | - | |
| GO:0043204 | perikaryon | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
| CHEBOTAEV GR TARGETS UP | 77 | 62 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS F UP | 185 | 119 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE S | 162 | 86 | All SZGR 2.0 genes in this pathway |
| WIERENGA STAT5A TARGETS UP | 217 | 131 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-103/107 | 328 | 334 | 1A | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
| hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
| miR-299-5p | 237 | 243 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-30-5p | 253 | 260 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-325 | 309 | 316 | 1A,m8 | hsa-miR-325 | CCUAGUAGGUGUCCAGUAAGUGU |
| miR-369-3p | 162 | 168 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-374 | 162 | 168 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| miR-543 | 317 | 323 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.