Gene Page: SIKE1
Summary ?
| GeneID | 80143 |
| Symbol | SIKE1 |
| Synonyms | SIKE |
| Description | suppressor of IKBKE 1 |
| Reference | MIM:611656|HGNC:HGNC:26119|Ensembl:ENSG00000052723|HPRD:07958|Vega:OTTHUMG00000012061 |
| Gene type | protein-coding |
| Map location | 1p13.2 |
| Pascal p-value | 2.936E-4 |
| eGene | Anterior cingulate cortex BA24 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs577918359 | 1 | 115254238 | SIKE1 | ENSG00000052723.7 | 7.83169E-7 | 0.02 | 69068 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SHROOM4 | 0.80 | 0.72 |
| TJP1 | 0.78 | 0.74 |
| PDE8A | 0.78 | 0.75 |
| SLC12A2 | 0.78 | 0.73 |
| GLDN | 0.78 | 0.75 |
| TMC7 | 0.77 | 0.73 |
| DOCK5 | 0.77 | 0.64 |
| AC022100.1 | 0.77 | 0.69 |
| PLEKHH1 | 0.77 | 0.69 |
| KIF13B | 0.76 | 0.62 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RPL35 | -0.51 | -0.67 |
| RPL27 | -0.50 | -0.67 |
| RPL36 | -0.49 | -0.68 |
| RPS9 | -0.48 | -0.65 |
| FAU | -0.48 | -0.64 |
| RPL18 | -0.48 | -0.66 |
| RPL31 | -0.48 | -0.64 |
| RPS20 | -0.48 | -0.67 |
| RPL8 | -0.47 | -0.61 |
| RPS3P3 | -0.47 | -0.64 |
Section III. Gene Ontology annotation
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| FAM40A | FLJ14743 | KIAA1761 | MGC148091 | RP4-773N10.1 | family with sequence similarity 40, member A | Affinity Capture-MS | BioGRID | 18782753 |
| FAM40B | - | family with sequence similarity 40, member B | Affinity Capture-MS | BioGRID | 18782753 |
| FGFR1OP2 | DKFZp564O1863 | HSPC123-like | FGFR1 oncogene partner 2 | Affinity Capture-MS | BioGRID | 18782753 |
| MOBKL3 | 2C4D | CGI-95 | MGC12264 | MOB1 | MOB3 | PREI3 | MOB1, Mps One Binder kinase activator-like 3 (yeast) | Affinity Capture-MS | BioGRID | 18782753 |
| PDCD10 | CCM3 | MGC1212 | MGC24477 | TFAR15 | programmed cell death 10 | Affinity Capture-MS | BioGRID | 18782753 |
| PPP2CA | PP2Ac | PP2CA | RP-C | protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform | Affinity Capture-MS | BioGRID | 18782753 |
| PPP2R1A | MGC786 | PR65A | protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform | Affinity Capture-MS | BioGRID | 18782753 |
| RP6-213H19.1 | MASK | MST4 | serine/threonine protein kinase MST4 | Affinity Capture-MS | BioGRID | 18782753 |
| SLMAP | FLJ42206 | KIAA1601 | MGC138760 | MGC138761 | SLAP | sarcolemma associated protein | Affinity Capture-MS | BioGRID | 18782753 |
| STK24 | MST-3 | MST3 | MST3B | STE20 | STK3 | serine/threonine kinase 24 (STE20 homolog, yeast) | Affinity Capture-MS | BioGRID | 18782753 |
| STK25 | DKFZp686J1430 | SOK1 | YSK1 | serine/threonine kinase 25 (STE20 homolog, yeast) | Affinity Capture-MS | BioGRID | 18782753 |
| STRN | MGC125642 | SG2NA | striatin, calmodulin binding protein | Affinity Capture-MS | BioGRID | 18782753 |
| STRN3 | SG2NA | striatin, calmodulin binding protein 3 | Affinity Capture-MS | BioGRID | 18782753 |
| STRN4 | FLJ35594 | ZIN | zinedin | striatin, calmodulin binding protein 4 | Affinity Capture-MS | BioGRID | 18782753 |
| TRAF3IP3 | DJ434O14.3 | FLJ44151 | MGC117354 | MGC163289 | T3JAM | TRAF3 interacting protein 3 | Affinity Capture-MS Affinity Capture-Western | BioGRID | 18782753 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG RIG I LIKE RECEPTOR SIGNALING PATHWAY | 71 | 51 | All SZGR 2.0 genes in this pathway |
| REACTOME TRAF6 MEDIATED IRF7 ACTIVATION | 30 | 26 | All SZGR 2.0 genes in this pathway |
| REACTOME TRAF3 DEPENDENT IRF ACTIVATION PATHWAY | 14 | 10 | All SZGR 2.0 genes in this pathway |
| REACTOME RIG I MDA5 MEDIATED INDUCTION OF IFN ALPHA BETA PATHWAYS | 73 | 57 | All SZGR 2.0 genes in this pathway |
| REACTOME INNATE IMMUNE SYSTEM | 279 | 178 | All SZGR 2.0 genes in this pathway |
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
| XU HGF TARGETS REPRESSED BY AKT1 DN | 95 | 58 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM6 | 46 | 32 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| LANDEMAINE LUNG METASTASIS | 21 | 12 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
| DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
| KANG DOXORUBICIN RESISTANCE DN | 19 | 8 | All SZGR 2.0 genes in this pathway |
| JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
| LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
| CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
| PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-17-5p/20/93.mr/106/519.d | 534 | 541 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
| hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
| hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
| hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
| hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
| hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
| miR-29 | 519 | 526 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.