Summary ?
GeneID80317
SymbolZKSCAN3
SynonymsZF47|ZFP306|ZNF306|ZNF309|ZSCAN13|ZSCAN35|Zfp47|dJ874C20.1|dJ874C20.1.|zfp-47
Descriptionzinc finger with KRAB and SCAN domains 3
ReferenceMIM:612791|HGNC:HGNC:13853|Ensembl:ENSG00000189298|HPRD:11705|Vega:OTTHUMG00000014521
Gene typeprotein-coding
Map location6p22.1
Pascal p-value1E-12
eGeneCerebellar Hemisphere
Frontal Cortex BA9
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IGenome scan meta-analysisPsr: 0.033 

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs16869851chr420690056ZKSCAN3803170.11trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
GIMAP60.550.50
AOC30.540.53
GJA50.540.46
EMCN0.480.42
FAM26E0.480.42
PGM50.470.52
CALCRL0.460.46
ASPN0.450.42
GIMAP40.450.43
CARD60.450.44
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AC132872.1-0.28-0.37
UPF3A-0.28-0.32
RBMX2-0.26-0.39
ANKZF1-0.26-0.29
SFRS16-0.26-0.26
SNHG12-0.25-0.38
RP9-0.25-0.34
PABPN1-0.25-0.30
C22orf23-0.25-0.27
TEKT2-0.25-0.28

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME GENERIC TRANSCRIPTION PATHWAY 352181All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375806All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 17811082All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770415All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882572All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP 244165All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE UP 9564All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP 393244All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP 196137All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506422428m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC