Summary ?
GeneID80346
SymbolREEP4
SynonymsC8orf20|PP432|Yip2c
Descriptionreceptor accessory protein 4
ReferenceMIM:609349|HGNC:HGNC:26176|Ensembl:ENSG00000168476|HPRD:09864|Vega:OTTHUMG00000131491
Gene typeprotein-coding
Map location8p21.3
Pascal p-value0.427
Sherlock p-value0.396
Fetal beta0.402
DMG1 (# studies)
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
DMG:Nishioka_2013Genome-wide DNA methylation analysisThe authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 1
GSMA_IGenome scan meta-analysisPsr: 0.031 
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.03086 
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.00057 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg16256610821999381REEP4-0.020.85DMG:Nishioka_2013

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs10842688chr1226338293REEP4803460.15trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
DAVICIONI MOLECULAR ARMS VS ERMS DN 182111All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN 463290All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848527All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024594All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP 487303All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566371All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C 463262All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210725All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839928All SZGR 2.0 genes in this pathway
ZWANG EGF INTERVAL DN 214124All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-26357363m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-9190196m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA