Gene Page: CUL5
Summary ?
| GeneID | 8065 |
| Symbol | CUL5 |
| Synonyms | VACM-1|VACM1 |
| Description | cullin 5 |
| Reference | MIM:601741|HGNC:HGNC:2556|Ensembl:ENSG00000166266|HPRD:03444|Vega:OTTHUMG00000166369 |
| Gene type | protein-coding |
| Map location | 11q22.3 |
| Pascal p-value | 0.314 |
| eGene | Myers' cis & trans |
| Support | G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0125 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7132043 | chr12 | 80968399 | CUL5 | 8065 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004872 | receptor activity | TAS | 9581826 | |
| GO:0005515 | protein binding | IPI | 12504025 | |
| GO:0005262 | calcium channel activity | TAS | 9581826 | |
| GO:0031625 | ubiquitin protein ligase binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000082 | G1/S transition of mitotic cell cycle | TAS | 8681378 | |
| GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - | |
| GO:0007050 | cell cycle arrest | TAS | 8681378 | |
| GO:0008285 | negative regulation of cell proliferation | TAS | 8681378 | |
| GO:0008629 | induction of apoptosis by intracellular signals | TAS | 9581826 | |
| GO:0044419 | interspecies interaction between organisms | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005794 | Golgi apparatus | IDA | 18029348 | |
| GO:0005829 | cytosol | EXP | 14564014 |15781449 | |
| GO:0005737 | cytoplasm | IDA | 18029348 | |
| GO:0031461 | cullin-RING ubiquitin ligase complex | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG UBIQUITIN MEDIATED PROTEOLYSIS | 138 | 98 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY ERBB2 | 101 | 78 | All SZGR 2.0 genes in this pathway |
| REACTOME HIV INFECTION | 207 | 122 | All SZGR 2.0 genes in this pathway |
| REACTOME HOST INTERACTIONS OF HIV FACTORS | 132 | 81 | All SZGR 2.0 genes in this pathway |
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
| REACTOME CLASS I MHC MEDIATED ANTIGEN PROCESSING PRESENTATION | 251 | 156 | All SZGR 2.0 genes in this pathway |
| REACTOME ANTIGEN PROCESSING UBIQUITINATION PROTEASOME DEGRADATION | 212 | 129 | All SZGR 2.0 genes in this pathway |
| REACTOME VIF MEDIATED DEGRADATION OF APOBEC3G | 52 | 30 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER WITH LOH IN CHR9Q | 116 | 71 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE AUGMENTED BY MYC | 108 | 74 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| GEORGES CELL CYCLE MIR192 TARGETS | 62 | 46 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| LINDVALL IMMORTALIZED BY TERT DN | 80 | 56 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS INTERMEDIATE PROGENITOR | 149 | 84 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| DE YY1 TARGETS DN | 92 | 64 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| SAKAI CHRONIC HEPATITIS VS LIVER CANCER UP | 83 | 63 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| NIELSEN GIST | 98 | 66 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN | 106 | 77 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 120 | 126 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 120 | 126 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-148/152 | 393 | 400 | 1A,m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
| hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
| hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
| miR-181 | 3212 | 3218 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-182 | 1123 | 1130 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-186 | 2255 | 2261 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-19 | 189 | 195 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-217 | 3277 | 3284 | 1A,m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
| miR-299-5p | 1923 | 1929 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-31 | 1122 | 1128 | 1A | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
| miR-324-5p | 3056 | 3062 | m8 | hsa-miR-324-5p | CGCAUCCCCUAGGGCAUUGGUGU |
| miR-33 | 2023 | 2029 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
| miR-370 | 643 | 649 | 1A | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
| miR-381 | 3335 | 3341 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-410 | 1148 | 1154 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-433-3p | 234 | 240 | 1A | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
| miR-493-5p | 1134 | 1140 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-96 | 1124 | 1130 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.