Summary ?
GeneID8085
SymbolKMT2D
SynonymsAAD10|ALR|CAGL114|KABUK1|KMS|MLL2|MLL4|TNRC21
Descriptionlysine methyltransferase 2D
ReferenceMIM:602113|HGNC:HGNC:7133|Ensembl:ENSG00000167548|HPRD:03664|Vega:OTTHUMG00000166524
Gene typeprotein-coding
Map location12q13.12
Pascal p-value0.018

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DNM:McCarthy_2014Whole Exome Sequencing analysisWhole exome sequencing of 57 trios with sporadic or familial schizophrenia.
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingNAS9247308 
GO:0005515protein bindingIPI16603732 
GO:0016740transferase activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0008168methyltransferase activityIEA-
GO:0018024histone-lysine N-methyltransferase activityIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001701in utero embryonic developmentIEA-
GO:0006355regulation of transcription, DNA-dependentNAS9247308 
GO:0006350transcriptionIEA-
GO:0016568chromatin modificationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusNAS9247308 
GO:0035097histone methyltransferase complexIPI14992727 

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/986746811A,m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-103/107166316691Ahsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-13411201126m8hsa-miR-134brainUGUGACUGGUUGACCAGAGGG
miR-139226322691Ahsa-miR-139brainUCUACAGUGCACGUGUCU
miR-142-5p133513411Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-1432712771Ahsa-miR-143brainUGAGAUGAAGCACUGUAGCUCA
miR-14617701776m8hsa-miR-146aUGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrainUGAGAACUGAAUUCCAUAGGCU
miR-149160516121A,m8hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-15/16/195/424/49711321138m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-204/2115561m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-210157715841A,m8hsa-miR-210CUGUGCGUGUGACAGCGGCUGA
miR-214368374m8hsa-miR-214brainACAGCAGGCACAGACAGGCAG
hsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-21717661772m8hsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-219430436m8hsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
miR-23711717m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-30-5p243824441Ahsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-3237117171Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-329257025761Ahsa-miR-329brainAACACACCUGGUUAACCUCUUU
miR-335905961Ahsa-miR-33GUGCAUUGUAGUUGCAUUG
hsa-miR-33bGUGCAUUGCUGUUGCAUUGCA
miR-33115981604m8hsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
hsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
miR-338187718831Ahsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
miR-34/449762768m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-3427137191Ahsa-miR-342brainUCUCACACAGAAAUCGCACCCGUC
miR-34622252231m8hsa-miR-346brainUGUCUGCCCGCAUGCCUGCCUCU
miR-36517971803m8hsa-miR-365UAAUGCCCCUAAAAAUCCUUAU
miR-3701341401Ahsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
miR-377253825441Ahsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-410133713431Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
hsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-4889279331Ahsa-miR-488CCCAGAUAAUGGCACUCUCAA
miR-49114881494m8hsa-miR-491brainAGUGGGGAACCCUUCCAUGAGGA
miR-494200020061Ahsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-49527612767m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-496131213181Ahsa-miR-496AUUACAUGGCCAAUCUC