Gene Page: FXR1
Summary ?
GeneID | 8087 |
Symbol | FXR1 |
Synonyms | FXR1P |
Description | FMR1 autosomal homolog 1 |
Reference | MIM:600819|HGNC:HGNC:4023|Ensembl:ENSG00000114416|HPRD:02892|Vega:OTTHUMG00000158138 |
Gene type | protein-coding |
Map location | 3q28 |
Pascal p-value | 1.075E-10 |
Sherlock p-value | 0.087 |
Fetal beta | 0.731 |
DMG | 2 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
CV:PGC128
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg27437944 | 3 | 180630533 | FXR1 | -0.027 | 0.51 | DMG:Nishioka_2013 | |
cg19678270 | 3 | 180630780 | FXR1 | 6.27E-8 | -0.01 | 1.56E-5 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1324669 | chr13 | 107872446 | FXR1 | 8087 | 0.01 | trans | ||
rs9949772 | chr18 | 31042632 | FXR1 | 8087 | 0.13 | trans | ||
rs17145698 | chrX | 40218345 | FXR1 | 8087 | 0.08 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003723 | RNA binding | TAS | 7781595 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007519 | skeletal muscle development | IEA | neuron (GO term level: 8) | - |
GO:0006915 | apoptosis | TAS | 9642279 | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005844 | polysome | TAS | 9817930 | |
GO:0005730 | nucleolus | TAS | 10888599 | |
GO:0005737 | cytoplasm | TAS | 7781595 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
C14orf1 | ERG28 | NET51 | chromosome 14 open reading frame 1 | Two-hybrid | BioGRID | 16169070 |
C1orf103 | FLJ11269 | RIF1 | RP11-96K19.1 | chromosome 1 open reading frame 103 | Two-hybrid | BioGRID | 16169070 |
CRMP1 | DPYSL1 | DRP-1 | DRP1 | collapsin response mediator protein 1 | Two-hybrid | BioGRID | 16169070 |
CYFIP1 | FLJ45151 | P140SRA-1 | SHYC | SRA1 | cytoplasmic FMR1 interacting protein 1 | Affinity Capture-Western | BioGRID | 11438699 |
CYFIP2 | PIR121 | cytoplasmic FMR1 interacting protein 2 | - | HPRD,BioGRID | 11438699 |
FMR1 | FMRP | FRAXA | MGC87458 | POF | POF1 | fragile X mental retardation 1 | - | HPRD,BioGRID | 7489725 |8668200 |
FXR1 | - | fragile X mental retardation, autosomal homolog 1 | - | HPRD,BioGRID | 7489725 |
FXR2 | FMR1L2 | fragile X mental retardation, autosomal homolog 2 | - | HPRD,BioGRID | 7489725 |8668200 |
GBP2 | - | guanylate binding protein 2, interferon-inducible | Two-hybrid | BioGRID | 16169070 |
KIAA1377 | - | KIAA1377 | Two-hybrid | BioGRID | 16169070 |
LUC7L2 | CGI-59 | CGI-74 | FLJ10657 | LUC7B2 | LUC7-like 2 (S. cerevisiae) | Two-hybrid | BioGRID | 16169070 |
PRSS23 | MGC5107 | SIG13 | SPUVE | ZSIG13 | protease, serine, 23 | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP | 185 | 126 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 6HR DN | 167 | 100 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
GRAHAM CML QUIESCENT VS NORMAL DIVIDING UP | 57 | 33 | All SZGR 2.0 genes in this pathway |
GRAHAM NORMAL QUIESCENT VS NORMAL DIVIDING UP | 66 | 47 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES SKIN UP | 177 | 113 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
IVANOV MUTATED IN COLON CANCER | 13 | 9 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
AMUNDSON RESPONSE TO ARSENITE | 217 | 143 | All SZGR 2.0 genes in this pathway |
YANG BREAST CANCER ESR1 LASER DN | 50 | 38 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 60 HELA | 46 | 32 | All SZGR 2.0 genes in this pathway |
DING LUNG CANCER EXPRESSION BY COPY NUMBER | 100 | 62 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
DORSAM HOXA9 TARGETS DN | 32 | 22 | All SZGR 2.0 genes in this pathway |
HADDAD T LYMPHOCYTE AND NK PROGENITOR UP | 78 | 56 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C8 | 72 | 56 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
JIANG VHL TARGETS | 138 | 91 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY DN | 145 | 88 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR UP | 178 | 111 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 8G | 95 | 62 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
HONMA DOCETAXEL RESISTANCE | 34 | 23 | All SZGR 2.0 genes in this pathway |
SPIRA SMOKERS LUNG CANCER UP | 38 | 24 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
ZHAN VARIABLE EARLY DIFFERENTIATION GENES DN | 30 | 19 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G3 UP | 188 | 121 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
WHITFIELD CELL CYCLE M G1 | 148 | 95 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
BILANGES RAPAMYCIN SENSITIVE VIA TSC1 AND TSC2 | 73 | 37 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-132/212 | 581 | 587 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-145 | 524 | 530 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-182 | 64 | 71 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-199 | 523 | 529 | 1A | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-200bc/429 | 627 | 633 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-25/32/92/363/367 | 815 | 822 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-30-3p | 706 | 713 | 1A,m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-30-5p | 18 | 24 | 1A | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-31 | 63 | 69 | 1A | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
miR-320 | 648 | 654 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-324-3p | 575 | 582 | 1A,m8 | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
miR-493-5p | 55 | 61 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
miR-7 | 856 | 862 | 1A | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
miR-9 | 67 | 73 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-96 | 65 | 71 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.