Gene Page: RBM10
Summary ?
| GeneID | 8241 |
| Symbol | RBM10 |
| Synonyms | DXS8237E|GPATC9|GPATCH9|S1-1|TARPS|ZRANB5 |
| Description | RNA binding motif protein 10 |
| Reference | MIM:300080|HGNC:HGNC:9896|Ensembl:ENSG00000182872|HPRD:02095|Vega:OTTHUMG00000021432 |
| Gene type | protein-coding |
| Map location | Xp11.23 |
| Sherlock p-value | 0.352 |
| Fetal beta | -0.826 |
| eGene | Myers' cis & trans |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17762315 | chr5 | 76807576 | RBM10 | 8241 | 0.08 | trans | ||
| rs4265582 | chr11 | 18797649 | RBM10 | 8241 | 0.2 | trans | ||
| rs1265412 | chrX | 147942079 | RBM10 | 8241 | 0.1 | trans | ||
| rs5936455 | chrX | 147949110 | RBM10 | 8241 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HIST1H2AE | 0.71 | 0.51 |
| EIF3G | 0.67 | 0.60 |
| HIST1H2BG | 0.67 | 0.44 |
| SLC25A6 | 0.66 | 0.62 |
| C7orf11 | 0.65 | 0.57 |
| SNRPC | 0.65 | 0.61 |
| PQBP1 | 0.65 | 0.61 |
| FARS2 | 0.65 | 0.57 |
| THOC4 | 0.65 | 0.57 |
| EEF1D | 0.65 | 0.56 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.27 | -0.42 | -0.49 |
| MT-CYB | -0.41 | -0.47 |
| MT-CO2 | -0.40 | -0.44 |
| AF347015.33 | -0.40 | -0.47 |
| AF347015.8 | -0.40 | -0.47 |
| AF347015.15 | -0.39 | -0.47 |
| AF347015.31 | -0.39 | -0.44 |
| AF347015.2 | -0.38 | -0.45 |
| AF347015.26 | -0.37 | -0.45 |
| C5orf53 | -0.36 | -0.39 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003676 | nucleic acid binding | IEA | - | |
| GO:0003723 | RNA binding | NAS | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008150 | biological_process | ND | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | NAS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
| JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS C UP | 170 | 114 | All SZGR 2.0 genes in this pathway |
| MATTIOLI MGUS VS PCL | 116 | 62 | All SZGR 2.0 genes in this pathway |
| LIAO HAVE SOX4 BINDING SITES | 40 | 26 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| SMITH TERT TARGETS UP | 145 | 91 | All SZGR 2.0 genes in this pathway |
| NELSON RESPONSE TO ANDROGEN UP | 86 | 61 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA UP | 64 | 46 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| TSENG IRS1 TARGETS DN | 135 | 88 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 LCP WITH H3K4ME3 | 162 | 80 | All SZGR 2.0 genes in this pathway |
| KYNG RESPONSE TO H2O2 VIA ERCC6 DN | 46 | 31 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS DURATION CORR DN | 146 | 90 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-326 | 115 | 121 | 1A | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.