SZGR2

Summary ?

GeneID	8312
Symbol	AXIN1
Synonyms	AXIN\|PPP1R49
Description	axin 1
Reference	MIM:603816\|HGNC:HGNC:903\|Ensembl:ENSG00000103126\|HPRD:04819\|Vega:OTTHUMG00000064930
Gene type	protein-coding
Map location	16p13.3
Pascal p-value	0.019
Sherlock p-value	1.748E-4
Fetal beta	0.799
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Myers' cis & trans Meta
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0179

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg06387245	16	348076	AXIN1	1.61E-5	0.476	0.015	DMG:Wockner_2014
cg10500953	16	346518	AXIN1	9.97E-5	0.202	0.028	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs2885415	chr16	395395	AXIN1	8312		0.08		cis
rs16993189	chrX	144666166	AXIN1	8312		0.07		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004871	signal transducer activity	NAS		9230313
GO:0005515	protein binding	IPI		9601641 \|12192039
GO:0042803	protein homodimerization activity	ISS		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007605	sensory perception of sound	IEA		-
GO:0006915	apoptosis	IEA		-
GO:0007309	oocyte axis specification	TAS		9230313
GO:0007275	multicellular organismal development	IEA		-
GO:0030178	negative regulation of Wnt receptor signaling pathway	IEA		-
GO:0030163	protein catabolic process	IEA		-
GO:0045786	negative regulation of cell cycle	IEA		-
GO:0046330	positive regulation of JNK cascade	ISS		-
GO:0060070	Wnt receptor signaling pathway through beta-catenin	IC		9601641
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	EXP		11955436 \|12000790 \|12820959 \|15327769 \|16753179
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IDA		12072559
GO:0005737	cytoplasm	IDA		12072559
GO:0016023	cytoplasmic membrane-bounded vesicle	IEA		-
GO:0016328	lateral plasma membrane	IDA		12072559
GO:0030877	beta-catenin destruction complex	IDA		9601641 \|16188939

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ANP32A	C15orf1 \| I1PP2A \| LANP \| MAPM \| MGC119787 \| MGC150373 \| PHAP1 \| PHAPI \| PP32	acidic (leucine-rich) nuclear phosphoprotein 32 family, member A	Two-hybrid	BioGRID	16169070
APC	BTPS2 \| DP2 \| DP2.5 \| DP3 \| GS	adenomatous polyposis coli	Reconstituted Complex Two-hybrid	BioGRID	9734785
APC	BTPS2 \| DP2 \| DP2.5 \| DP3 \| GS	adenomatous polyposis coli	-	HPRD	11297546
AXIN1	AXIN \| MGC52315	axin 1	Affinity Capture-Western Two-hybrid	BioGRID	11884395 \|16169070
CRMP1	DPYSL1 \| DRP-1 \| DRP1	collapsin response mediator protein 1	Two-hybrid	BioGRID	16169070
CSNK1A1	CK1 \| HLCDGP1 \| PRO2975	casein kinase 1, alpha 1	-	HPRD,BioGRID	11884395
CSNK1E	HCKIE \| MGC10398	casein kinase 1, epsilon	Affinity Capture-Western Phenotypic Suppression	BioGRID	11884395
CSNK1E	HCKIE \| MGC10398	casein kinase 1, epsilon	-	HPRD	11487578 \|12000790
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9734785 \|12805222
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	-	HPRD	12000790
DAB2	DOC-2 \| DOC2 \| FLJ26626	disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)	Reconstituted Complex	BioGRID	12805222
DIXDC1	CCD1 \| KIAA1735	DIX domain containing 1	-	HPRD	15262978
DVL1	DVL \| MGC54245	dishevelled, dsh homolog 1 (Drosophila)	Affinity Capture-Western	BioGRID	10428961
DVL1	DVL \| MGC54245	dishevelled, dsh homolog 1 (Drosophila)	-	HPRD	9482734 \|10330403
DVL2	-	dishevelled, dsh homolog 2 (Drosophila)	-	HPRD,BioGRID	10829020
DVL3	KIAA0208	dishevelled, dsh homolog 3 (Drosophila)	Affinity Capture-Western	BioGRID	12805222
EEF1A1	CCS-3 \| CCS3 \| EEF-1 \| EEF1A \| EF-Tu \| EF1A \| FLJ25721 \| GRAF-1EF \| HNGC:16303 \| LENG7 \| MGC102687 \| MGC131894 \| MGC16224 \| PTI1 \| eEF1A-1	eukaryotic translation elongation factor 1 alpha 1	Two-hybrid	BioGRID	16169070
GAK	FLJ16629 \| FLJ40395 \| MGC99654	cyclin G associated kinase	Two-hybrid	BioGRID	16169070
GSK3B	-	glycogen synthase kinase 3 beta	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9734785 \|12511557
LRP5	BMND1 \| EVR1 \| EVR4 \| HBM \| LR3 \| LRP7 \| OPPG \| OPS \| OPTA1 \| VBCH2	low density lipoprotein receptor-related protein 5	-	HPRD,BioGRID	11336703
MAP3K1	MAPKKK1 \| MEKK \| MEKK1	mitogen-activated protein kinase kinase kinase 1	Affinity Capture-Western	BioGRID	10829020 \|11884395
NCK2	GRB4 \| NCKbeta	NCK adaptor protein 2	-	HPRD	11557983
PIAS1	DDXBP1 \| GBP \| GU/RH-II \| MGC141878 \| MGC141879 \| ZMIZ3	protein inhibitor of activated STAT, 1	-	HPRD	12223491
PPP2R5A	B56A \| MGC131915 \| PR61A	protein phosphatase 2, regulatory subunit B', alpha isoform	Affinity Capture-Western Reconstituted Complex	BioGRID	11297546
SENP2	AXAM2 \| DKFZp762A2316 \| KIAA1331 \| SMT3IP2	SUMO1/sentrin/SMT3 specific peptidase 2	-	HPRD	11997515
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	-	HPRD	11438668
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	-	HPRD	11438668
SMYD2	HSKM-B \| KMT3C \| MGC119305 \| ZMYND14	SET and MYND domain containing 2	Affinity Capture-MS	BioGRID	17353931
TSC1	KIAA0243 \| LAM \| MGC86987 \| TSC	tuberous sclerosis 1	Affinity Capture-Western	BioGRID	12511557
TSC2	FLJ43106 \| LAM \| TSC4	tuberous sclerosis 2	Affinity Capture-Western	BioGRID	12511557
UTP14A	KIAA0266 \| NY-CO-16 \| SDCCAG16 \| dJ537K23.3	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG COLORECTAL CANCER	62	47	All SZGR 2.0 genes in this pathway
KEGG ENDOMETRIAL CANCER	52	45	All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA	55	44	All SZGR 2.0 genes in this pathway
BIOCARTA ALK PATHWAY	37	29	All SZGR 2.0 genes in this pathway
BIOCARTA GSK3 PATHWAY	27	26	All SZGR 2.0 genes in this pathway
BIOCARTA PITX2 PATHWAY	15	15	All SZGR 2.0 genes in this pathway
BIOCARTA PS1 PATHWAY	14	14	All SZGR 2.0 genes in this pathway
BIOCARTA WNT PATHWAY	26	24	All SZGR 2.0 genes in this pathway
WNT SIGNALING	89	71	All SZGR 2.0 genes in this pathway
ST WNT BETA CATENIN PATHWAY	34	28	All SZGR 2.0 genes in this pathway
PID BETA CATENIN DEG PATHWAY	18	17	All SZGR 2.0 genes in this pathway
PID PS1 PATHWAY	46	39	All SZGR 2.0 genes in this pathway
PID WNT CANONICAL PATHWAY	20	18	All SZGR 2.0 genes in this pathway
PID MYC PATHWAY	25	22	All SZGR 2.0 genes in this pathway
PID NCADHERIN PATHWAY	33	32	All SZGR 2.0 genes in this pathway
PID TGFBR PATHWAY	55	38	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY WNT	65	41	All SZGR 2.0 genes in this pathway
REACTOME CTNNB1 PHOSPHORYLATION CASCADE	16	11	All SZGR 2.0 genes in this pathway
BREUHAHN GROWTH FACTOR SIGNALING IN LIVER CANCER	22	19	All SZGR 2.0 genes in this pathway
YORDY RECIPROCAL REGULATION BY ETS1 AND SP100 DN	87	48	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 16P13 AMPLICON	120	49	All SZGR 2.0 genes in this pathway
LAMB CCND1 TARGETS	19	14	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS B LYMPHOCYTE DN	38	25	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE DN	87	59	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
SWEET KRAS ONCOGENIC SIGNATURE	89	56	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP	211	131	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP	281	183	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	433	439	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	433	439	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-128	464	470	m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	464	470	m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-203.1	558	564	m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-31	454	460	m8	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-493-5p	554	560	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-493-5p	554	560	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-539	560	567	1A,m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: AXIN1