Summary ?
GeneID83259
SymbolPCDH11Y
SynonymsPCDH-PC|PCDH22|PCDHX|PCDHY
Descriptionprotocadherin 11 Y-linked
ReferenceMIM:400022|HGNC:HGNC:15813|Ensembl:ENSG00000099715|HPRD:11847|Vega:OTTHUMG00000035105
Gene typeprotein-coding
Map locationYp11.2
Fetal beta0.84

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007155cell adhesionIEA-
GO:0007156homophilic cell adhesionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005730nucleolusIDA18029348 
GO:0005737cytoplasmIDA18029348 
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
GO:0043231intracellular membrane-bounded organelleIDA18029348 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
HAMAI APOPTOSIS VIA TRAIL DN 186107All SZGR 2.0 genes in this pathway
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE DN 9859All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP 390242All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 16911088All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 DN 228114All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177132All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-25/32/92/363/3677177241A,m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-33041364142m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-433-3p248254m8hsa-miR-433brainAUCAUGAUGGGCUCCUCGGUGU
miR-490172017261Ahsa-miR-490CAACCUGGAGGACUCCAUGCUG