SZGR2

Summary ?

GeneID	83439
Symbol	TCF7L1
Synonyms	TCF-3\|TCF3
Description	transcription factor 7 like 1
Reference	MIM:604652\|HGNC:HGNC:11640\|Ensembl:ENSG00000152284\|HPRD:06874\|Vega:OTTHUMG00000130026
Gene type	protein-coding
Map location	2p11.2
Pascal p-value	0.15
Sherlock p-value	0.727
Fetal beta	0.385
DMG	2 (# studies)
eGene	Cerebellum Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	3
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3
GSMA_I	Genome scan meta-analysis	Psr: 0.0004

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg21541159	2	85476431	TCF7L1	3.261E-4	0.362	0.04	DMG:Wockner_2014
cg04593571	2	85361052	TCF7L1	3.346E-4	-0.269	0.041	DMG:Wockner_2014
cg02508567	2	85361184	TCF7L1		-0.034	0.43	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs4501739	chrX	35960848	TCF7L1	83439		0.02		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ADPRHL2	0.84	0.82
MED22	0.82	0.76
PTOV1	0.81	0.78
SLC35B2	0.81	0.78
C2orf24	0.81	0.79
MAF1	0.80	0.76
ZFPL1	0.80	0.78
COBRA1	0.80	0.78
XKR8	0.79	0.76
TSSC4	0.79	0.76

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.27	-0.60	-0.67
MT-CO2	-0.58	-0.66
AF347015.8	-0.58	-0.67
AF347015.31	-0.58	-0.65
AF347015.33	-0.57	-0.64
AF347015.21	-0.57	-0.72
MT-CYB	-0.56	-0.65
AF347015.15	-0.55	-0.65
C5orf53	-0.53	-0.54
MT-ATP8	-0.53	-0.72

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	NAS		1741298 \|11085512
GO:0008013	beta-catenin binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006350	transcription	IEA		-
GO:0048319	axial mesoderm morphogenesis	IEA		-
GO:0006325	establishment or maintenance of chromatin architecture	NAS		1741298 \|11085512
GO:0030111	regulation of Wnt receptor signaling pathway	NAS		1741298 \|11085512
GO:0008595	determination of anterior/posterior axis, embryo	IEA		-
GO:0048863	stem cell differentiation	IEA		-
GO:0045892	negative regulation of transcription, DNA-dependent	IEA		-
GO:0046022	positive regulation of transcription from RNA polymerase II promoter, mitotic	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	NAS		1741298 \|11085512

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG ADHERENS JUNCTION	75	53	All SZGR 2.0 genes in this pathway
KEGG MELANOGENESIS	102	80	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG COLORECTAL CANCER	62	47	All SZGR 2.0 genes in this pathway
KEGG ENDOMETRIAL CANCER	52	45	All SZGR 2.0 genes in this pathway
KEGG PROSTATE CANCER	89	75	All SZGR 2.0 genes in this pathway
KEGG THYROID CANCER	29	26	All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA	55	44	All SZGR 2.0 genes in this pathway
KEGG ACUTE MYELOID LEUKEMIA	60	47	All SZGR 2.0 genes in this pathway
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC	76	59	All SZGR 2.0 genes in this pathway
WNT SIGNALING	89	71	All SZGR 2.0 genes in this pathway
PID BETA CATENIN NUC PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID DELTA NP63 PATHWAY	47	34	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN	142	95	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN	394	258	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
GROSS ELK3 TARGETS UP	27	16	All SZGR 2.0 genes in this pathway
GROSS HIF1A TARGETS UP	8	5	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN	411	249	All SZGR 2.0 genes in this pathway
BENPORATH ES 1	379	235	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS	179	105	All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED	100	68	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA UP	207	145	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM	302	191	All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS DN	57	42	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
NIKOLSKY OVERCONNECTED IN BREAST CANCER	22	19	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
BHATI G2M ARREST BY 2METHOXYESTRADIOL DN	127	75	All SZGR 2.0 genes in this pathway
WONG EMBRYONIC STEM CELL CORE	335	193	All SZGR 2.0 genes in this pathway
NIELSEN MALIGNAT FIBROUS HISTIOCYTOMA DN	18	11	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN	187	109	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
DURAND STROMA S UP	297	194	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-132/212	103	109	m8	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	103	109	m8	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-204/211	619	625	m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	619	625	m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-30-3p	229	236	1A,m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	229	236	1A,m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-329	828	834	1A	hsa-miR-329^brain	AACACACCUGGUUAACCUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TCF7L1