Gene Page: ARHGAP24
Summary ?
| GeneID | 83478 |
| Symbol | ARHGAP24 |
| Synonyms | FILGAP|RC-GAP72|RCGAP72|p73|p73RhoGAP |
| Description | Rho GTPase activating protein 24 |
| Reference | MIM:610586|HGNC:HGNC:25361|Ensembl:ENSG00000138639|HPRD:09804|Vega:OTTHUMG00000130427 |
| Gene type | protein-coding |
| Map location | 4q22.1 |
| Pascal p-value | 0.157 |
| DEG p-value | DEG:Sanders_2014:DS1_p=0.151:DS1_beta=0.034900:DS2_p=6.45e-02:DS2_beta=0.093:DS2_FDR=2.28e-01 |
| Fetal beta | -0.665 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DEG:Sanders_2013 | Microarray | Whole-genome gene expression profiles using microarrays on lymphoblastoid cell lines (LCLs) from 413 cases and 446 controls. | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005096 | GTPase activator activity | IEA | - | |
| GO:0005515 | protein binding | IPI | 16862148 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001525 | angiogenesis | IEA | - | |
| GO:0007165 | signal transduction | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0030154 | cell differentiation | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0042995 | cell projection | IEA | axon (GO term level: 4) | - |
| GO:0005856 | cytoskeleton | IEA | - | |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| LIU TARGETS OF VMYB VS CMYB DN | 43 | 30 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
| PETRETTO HEART MASS QTL CIS DN | 24 | 15 | All SZGR 2.0 genes in this pathway |
| MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
| IZADPANAH STEM CELL ADIPOSE VS BONE UP | 126 | 92 | All SZGR 2.0 genes in this pathway |
| BHATI G2M ARREST BY 2METHOXYESTRADIOL DN | 127 | 75 | All SZGR 2.0 genes in this pathway |
| WANG NEOPLASTIC TRANSFORMATION BY CCND1 MYC | 21 | 14 | All SZGR 2.0 genes in this pathway |
| MCMURRAY TP53 HRAS COOPERATION RESPONSE DN | 67 | 46 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
| ZWANG EGF INTERVAL DN | 214 | 124 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-141/200a | 197 | 203 | 1A | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-145 | 205 | 211 | m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
| miR-194 | 199 | 205 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
| miR-21 | 361 | 368 | 1A,m8 | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
| hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
| miR-496 | 555 | 561 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-9 | 161 | 167 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
| miR-93.hd/291-3p/294/295/302/372/373/520 | 352 | 358 | 1A | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
| hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
| hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
| hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
| hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
| hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
| hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
| hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
| hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
| hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
| hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
| hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU | ||||
| miR-96 | 521 | 527 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.