SZGR2

Summary ?

GeneID	83931
Symbol	STK40
Synonyms	SHIK\|SgK495
Description	serine/threonine kinase 40
Reference	MIM:609437\|HGNC:HGNC:21373\|Ensembl:ENSG00000196182\|HPRD:11359\|Vega:OTTHUMG00000008238
Gene type	protein-coding
Map location	1p34.3
Pascal p-value	0.589
Sherlock p-value	0.378
Fetal beta	0.501
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Montano_2016	Genome-wide DNA methylation analysis	This dataset includes 172 replicated associations between CpGs with schizophrenia.	1
Expression	Meta-analysis of gene expression	P value: 1.836

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg25722983	1	36840028	STK40	5.27E-5	-0.007	0.098	DMG:Montano_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs16858695	chr1	162193737	STK40	83931	0.2	trans
rs2014805	chr2	175165192	STK40	83931	0.06	trans
rs7593761	chr2	197275602	STK40	83931	0.17	trans
rs16827037	chr3	117203284	STK40	83931	0.13	trans
rs7664027	chr4	169121200	STK40	83931	0.01	trans
rs17053782	chr4	169127022	STK40	83931	0.01	trans
rs11722969	chr4	169133757	STK40	83931	0.01	trans
rs6846811	chr4	169234535	STK40	83931	0.14	trans
rs904451	chr4	186630945	STK40	83931	0.08	trans
rs887719	chr7	21184272	STK40	83931	0.07	trans
rs320082	chr7	29105404	STK40	83931	0	trans
rs317720	chr7	29110633	STK40	83931	0.08	trans
rs317714	chr7	29115553	STK40	83931	1.473E-5	trans
rs317724	chr7	29120565	STK40	83931	0.08	trans
rs7850851	chr9	37928770	STK40	83931	0.15	trans
rs10834670	chr11	25404015	STK40	83931	0.14	trans
rs10834671	chr11	25404269	STK40	83931	0.11	trans
rs4497566	chr13	51694324	STK40	83931	8.11E-4	trans
rs1307687		0	STK40	83931	0.08	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0004674	protein serine/threonine kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005730	nucleolus	IDA		18029348
GO:0005737	cytoplasm	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
SENESE HDAC2 TARGETS DN	133	77	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
GALINDO IMMUNE RESPONSE TO ENTEROTOXIN	85	67	All SZGR 2.0 genes in this pathway
SARTIPY NORMAL AT INSULIN RESISTANCE UP	34	27	All SZGR 2.0 genes in this pathway
YAMANAKA GLIOBLASTOMA SURVIVAL UP	11	7	All SZGR 2.0 genes in this pathway
YOSHIOKA LIVER CANCER EARLY RECURRENCE DN	65	31	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway
KUMAR PATHOGEN LOAD BY MACROPHAGES	275	155	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	259	265	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-129-5p	2045	2051	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	2045	2051	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-134	2040	2046	1A	hsa-miR-134^brain	UGUGACUGGUUGACCAGAGGG
miR-137	2103	2109	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-137	2103	2109	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-21	387	393	m8	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	387	393	m8	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-31	1475	1482	1A,m8	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-31	1475	1482	1A,m8	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-381	2054	2060	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: STK40