Gene Page: PIP5K1A
Summary ?
| GeneID | 8394 |
| Symbol | PIP5K1A |
| Synonyms | - |
| Description | phosphatidylinositol-4-phosphate 5-kinase, type I, alpha |
| Reference | MIM:603275|HGNC:HGNC:8994|Ensembl:ENSG00000143398|Vega:OTTHUMG00000012351 |
| Gene type | protein-coding |
| Map location | 1q21.3 |
| Sherlock p-value | 0.142 |
| Fetal beta | 0.759 |
| DMG | 2 (# studies) |
| eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum Nucleus accumbens basal ganglia Putamen basal ganglia Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg09166705 | 1 | 151170883 | PIP5K1A | 4.46E-5 | -0.493 | 0.021 | DMG:Wockner_2014 |
| cg20854748 | 1 | 151170914 | PIP5K1A | -0.025 | 0.27 | DMG:Nishioka_2013 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17055195 | chr3 | 55369565 | PIP5K1A | 8394 | 0.17 | trans | ||
| rs17055216 | chr3 | 55381947 | PIP5K1A | 8394 | 0.17 | trans | ||
| rs17055218 | chr3 | 55382206 | PIP5K1A | 8394 | 0.17 | trans | ||
| rs17055224 | chr3 | 55383487 | PIP5K1A | 8394 | 0.17 | trans | ||
| rs17055232 | chr3 | 55385671 | PIP5K1A | 8394 | 0.17 | trans | ||
| rs17055233 | chr3 | 55385691 | PIP5K1A | 8394 | 0.17 | trans | ||
| rs6445730 | chr3 | 55386217 | PIP5K1A | 8394 | 0.17 | trans | ||
| rs747266 | chr3 | 55387379 | PIP5K1A | 8394 | 0.17 | trans | ||
| rs3811402 | 1 | 151119745 | PIP5K1A | ENSG00000143398.15 | 4.55127E-6 | 0.03 | -50680 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SEL1L | 0.94 | 0.96 |
| NF1 | 0.94 | 0.95 |
| C11orf41 | 0.94 | 0.95 |
| MTOR | 0.93 | 0.96 |
| MGAT5 | 0.93 | 0.96 |
| PLEKHM3 | 0.93 | 0.96 |
| ASH1L | 0.93 | 0.94 |
| UBE4A | 0.93 | 0.95 |
| MEGF9 | 0.93 | 0.95 |
| PIKFYVE | 0.93 | 0.94 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.66 | -0.70 |
| FXYD1 | -0.66 | -0.68 |
| AF347015.21 | -0.66 | -0.73 |
| HIGD1B | -0.65 | -0.71 |
| C1orf54 | -0.65 | -0.78 |
| MT-CO2 | -0.64 | -0.69 |
| ENHO | -0.63 | -0.69 |
| SAT1 | -0.63 | -0.70 |
| S100A16 | -0.62 | -0.66 |
| TLCD1 | -0.62 | -0.65 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016740 | transferase activity | IEA | - | |
| GO:0016308 | 1-phosphatidylinositol-4-phosphate 5-kinase activity | NAS | - | |
| GO:0016301 | kinase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007165 | signal transduction | TAS | 8955136 | |
| GO:0006650 | glycerophospholipid metabolic process | TAS | 8955136 | |
| GO:0016310 | phosphorylation | NAS | - | |
| GO:0046488 | phosphatidylinositol metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0012505 | endomembrane system | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005575 | cellular_component | ND | - | |
| GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG INOSITOL PHOSPHATE METABOLISM | 54 | 42 | All SZGR 2.0 genes in this pathway |
| KEGG PHOSPHATIDYLINOSITOL SIGNALING SYSTEM | 76 | 56 | All SZGR 2.0 genes in this pathway |
| KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
| KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS | 97 | 71 | All SZGR 2.0 genes in this pathway |
| KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
| BIOCARTA RHO PATHWAY | 32 | 23 | All SZGR 2.0 genes in this pathway |
| PID RHOA PATHWAY | 45 | 33 | All SZGR 2.0 genes in this pathway |
| PID AVB3 OPN PATHWAY | 31 | 29 | All SZGR 2.0 genes in this pathway |
| PID ARF6 DOWNSTREAM PATHWAY | 15 | 14 | All SZGR 2.0 genes in this pathway |
| PID ECADHERIN KERATINOCYTE PATHWAY | 21 | 19 | All SZGR 2.0 genes in this pathway |
| PID ARF 3PATHWAY | 19 | 13 | All SZGR 2.0 genes in this pathway |
| PID RAC1 PATHWAY | 54 | 37 | All SZGR 2.0 genes in this pathway |
| DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
| RODRIGUES NTN1 TARGETS DN | 158 | 102 | All SZGR 2.0 genes in this pathway |
| WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| NAGASHIMA NRG1 SIGNALING DN | 58 | 35 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| YANAGIHARA ESX1 TARGETS | 30 | 19 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| LOCKWOOD AMPLIFIED IN LUNG CANCER | 214 | 139 | All SZGR 2.0 genes in this pathway |
| WEI MIR34A TARGETS | 148 | 97 | All SZGR 2.0 genes in this pathway |
| AMIT EGF RESPONSE 40 HELA | 42 | 29 | All SZGR 2.0 genes in this pathway |
| AMIT SERUM RESPONSE 60 MCF10A | 57 | 42 | All SZGR 2.0 genes in this pathway |
| HANSON HRAS SIGNALING VIA NFKB | 22 | 14 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR UP | 180 | 125 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| SANSOM APC MYC TARGETS | 217 | 138 | All SZGR 2.0 genes in this pathway |
| HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
| LIN MELANOMA COPY NUMBER UP | 73 | 53 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
| IZADPANAH STEM CELL ADIPOSE VS BONE DN | 108 | 68 | All SZGR 2.0 genes in this pathway |
| SASAI TARGETS OF CXCR6 AND PTCH1 DN | 8 | 6 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP | 397 | 206 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-34/449 | 839 | 846 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.