Gene Page: FAM96A
Summary ?
| GeneID | 84191 |
| Symbol | FAM96A |
| Synonyms | - |
| Description | family with sequence similarity 96 member A |
| Reference | HGNC:HGNC:26235|Ensembl:ENSG00000166797|HPRD:08010|Vega:OTTHUMG00000132961 |
| Gene type | protein-coding |
| Map location | 15q22.31 |
| Pascal p-value | 0.002 |
| Sherlock p-value | 0.226 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Expression | Meta-analysis of gene expression | P value: 1.368 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003674 | molecular_function | ND | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008150 | biological_process | ND | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005575 | cellular_component | ND | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS UNANNOTATED DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 13 | 172 | 107 | All SZGR 2.0 genes in this pathway |
| MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| let-7/98 | 99 | 105 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
| hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
| hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
| hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
| hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
| hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
| hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
| hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
| hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
| miR-409-3p | 176 | 182 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.