Summary ?
GeneID84733
SymbolCBX2
SynonymsCDCA6|M33|SRXY5
Descriptionchromobox 2
ReferenceMIM:602770|HGNC:HGNC:1552|Ensembl:ENSG00000173894|HPRD:14397|Vega:OTTHUMG00000177463
Gene typeprotein-coding
Map location17q25.3
Pascal p-value0.017
Fetal beta2.232
eGeneCortex
SupportAscano FMRP targets
Chromatin Remodeling Genes

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
ExpressionMeta-analysis of gene expressionP value: 1.706 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0003682chromatin bindingIEA-
GO:0016564transcription repressor activityNAS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006333chromatin assembly or disassemblyIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0016568chromatin modificationNAS-
GO:0016481negative regulation of transcriptionNAS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000785chromatinIEA-
GO:0005634nucleusNAS-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
VECCHI GASTRIC CANCER EARLY UP 430232All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS TURQUOISE DN 5325All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316190All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375806All SZGR 2.0 genes in this pathway
MARKEY RB1 CHRONIC LOF UP 11578All SZGR 2.0 genes in this pathway
KONG E2F3 TARGETS 9758All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER UP 181108All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD UP 6439All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747453All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP 309199All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514319All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 UP 10866All SZGR 2.0 genes in this pathway
LIAO METASTASIS 539324All SZGR 2.0 genes in this pathway
GARCIA TARGETS OF FLI1 AND DAX1 DN 176104All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME UP 11069All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 307185All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN 258160All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871505All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN 841431All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882538All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98224230m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-124/50618411847m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-182158715931Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-21912681274m8hsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
miR-2924152421m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-30-5p24902496m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-3782602661Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-96158715931Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC