Summary ?
GeneID84870
SymbolRSPO3
SynonymsCRISTIN1|PWTSR|THSD2
DescriptionR-spondin 3
ReferenceMIM:610574|HGNC:HGNC:20866|HPRD:18181|
Gene typeprotein-coding
Map location6q22.33
Pascal p-value0.06
Fetal beta2.67
DMG1 (# studies)
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg198733826127439539RSPO33.51E-10-0.0117.25E-7DMG:Jaffe_2016

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs11592979chr10128327563RSPO3848700.11trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008201heparin bindingIEA-
GO:0009055electron carrier activityIEA-
GO:0051536iron-sulfur cluster bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016055Wnt receptor signaling pathwayIEA-
GO:0050896response to stimulusIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP 205140All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501327All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291176All SZGR 2.0 genes in this pathway
CHEBOTAEV GR TARGETS DN 12073All SZGR 2.0 genes in this pathway
THEODOROU MAMMARY TUMORIGENESIS 3124All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP 487286All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER A 10063All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN 371218All SZGR 2.0 genes in this pathway
LEE LIVER CANCER 4929All SZGR 2.0 genes in this pathway
OSADA ASCL1 TARGETS DN 2420All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1 9175All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745475All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364236All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR DN 244157All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A 182108All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN 308187All SZGR 2.0 genes in this pathway
NABA ECM GLYCOPROTEINS 19699All SZGR 2.0 genes in this pathway
NABA CORE MATRISOME 275148All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028559All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/206119125m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-103/1073137m8hsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-15/16/195/424/49732391A,m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-1881861931A,m8hsa-miR-188CAUCCCUUGCAUGGUGGAGGGU
hsa-miR-188CAUCCCUUGCAUGGUGGAGGGU
miR-204/211951957m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-409-3p118124m8hsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
miR-50333391Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG