Summary ?
GeneID84913
SymbolATOH8
SynonymsHATH6|bHLHa21
Descriptionatonal bHLH transcription factor 8
ReferenceHGNC:HGNC:24126|HPRD:09813|
Gene typeprotein-coding
Map location2p11.2
Pascal p-value0.152
Sherlock p-value0.904
DMG1 (# studies)

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_IGenome scan meta-analysisPsr: 0.0004 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg00400334285981962ATOH89.6E-10-0.0131.14E-6DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0030528transcription regulator activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE DN 6135All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREY DN 7444All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN 329219All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537339All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN 540340All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN 274165All SZGR 2.0 genes in this pathway
SEKI INFLAMMATORY RESPONSE LPS DN 2316All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 142103All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE 317190All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP 570339All SZGR 2.0 genes in this pathway
DURAND STROMA NS UP 162103All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/351131137m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-13310221028m8hsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-1377227291A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-1822922991A,m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-331102610331A,m8hsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
miR-92953011Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
miR-962932991Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC