Gene Page: PAQR8
Summary ?
| GeneID | 85315 |
| Symbol | PAQR8 |
| Synonyms | C6orf33|LMPB1|MPRB |
| Description | progestin and adipoQ receptor family member VIII |
| Reference | MIM:607780|HGNC:HGNC:15708|Ensembl:ENSG00000170915|HPRD:07415|Vega:OTTHUMG00000014846 |
| Gene type | protein-coding |
| Map location | 6p12.1 |
| Pascal p-value | 0.104 |
| Sherlock p-value | 0.593 |
| TADA p-value | 0.01 |
| Fetal beta | -1.983 |
| eGene | Cerebellar Hemisphere Cerebellum Cortex |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| PAQR8 | chr6 | 52268171 | G | A | NM_133367 | p.54G>S | missense | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
| ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
| HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
| YOSHIOKA LIVER CANCER EARLY RECURRENCE DN | 65 | 31 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP | 397 | 206 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 1505 | 1511 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 1504 | 1511 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-378 | 702 | 708 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-496 | 2913 | 2919 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.