Summary ?
GeneID85407
SymbolNKD1
SynonymsNaked1
Descriptionnaked cuticle homolog 1 (Drosophila)
ReferenceMIM:607851|HGNC:HGNC:17045|Ensembl:ENSG00000140807|HPRD:08482|Vega:OTTHUMG00000133169
Gene typeprotein-coding
Map location16q12.1
Pascal p-value0.006

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0005515protein bindingIPI15687260 |16567647 
GO:0004462lactoylglutathione lyase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016055Wnt receptor signaling pathwayIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG WNT SIGNALING PATHWAY 151112All SZGR 2.0 genes in this pathway
WNT SIGNALING 8971All SZGR 2.0 genes in this pathway
ST WNT BETA CATENIN PATHWAY 3428All SZGR 2.0 genes in this pathway
PID PS1 PATHWAY 4639All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA UP 14175All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP 428266All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC 5843All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP 176110All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS INTERFERON DN 5230All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435318All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A 898516All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN 187109All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080713All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725838All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98427433m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-15/16/195/424/4974234291Ahsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-36558641Ahsa-miR-365UAAUGCCCCUAAAAAUCCUUAU
miR-5034234291Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG