Gene Page: DOCK7
Summary ?
GeneID | 85440 |
Symbol | DOCK7 |
Synonyms | EIEE23|ZIR2 |
Description | dedicator of cytokinesis 7 |
Reference | MIM:615730|HGNC:HGNC:19190|Ensembl:ENSG00000116641|HPRD:16833|Vega:OTTHUMG00000013131 |
Gene type | protein-coding |
Map location | 1p31.3 |
Pascal p-value | 0.564 |
Sherlock p-value | 0.485 |
Fetal beta | 1.574 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 5 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg06595852 | 1 | 63154465 | DOCK7 | 1.123E-4 | 0.309 | 0.029 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs9875435 | chr3 | 28720220 | DOCK7 | 85440 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005085 | guanyl-nucleotide exchange factor activity | IEA | - | |
GO:0005525 | GTP binding | IEA | - | |
GO:0051020 | GTPase binding | IEA | - | |
GO:0048365 | Rac GTPase binding | IDA | 16982419 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007409 | axonogenesis | IMP | neuron, axon, neurite (GO term level: 12) | 16982419 |
GO:0031175 | neurite development | IMP | neuron, axon, neurite, dendrite (GO term level: 10) | 16982419 |
GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
GO:0000226 | microtubule cytoskeleton organization | IMP | 16982419 | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
GO:0033138 | positive regulation of peptidyl-serine phosphorylation | IMP | 16982419 | |
GO:0032863 | activation of Rac GTPase activity | IDA | 16982419 | |
GO:0045200 | establishment of neuroblast polarity | IMP | 16982419 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030426 | growth cone | TAS | axon, dendrite (GO term level: 5) | 16982419 |
GO:0030424 | axon | TAS | neuron, axon, Neurotransmitter (GO term level: 6) | 16982419 |
GO:0045178 | basal part of cell | TAS | 16982419 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID ERBB2 ERBB3 PATHWAY | 44 | 35 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
PAL PRMT5 TARGETS UP | 203 | 135 | All SZGR 2.0 genes in this pathway |
HEDENFALK BREAST CANCER BRCA1 VS BRCA2 | 163 | 113 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
BREDEMEYER RAG SIGNALING NOT VIA ATM UP | 62 | 29 | All SZGR 2.0 genes in this pathway |
BREDEMEYER RAG SIGNALING VIA ATM NOT VIA NFKB UP | 49 | 32 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-181 | 388 | 394 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-23 | 385 | 391 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-30-5p | 392 | 399 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-543 | 389 | 395 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.