SZGR2

Summary ?

GeneID	8600
Symbol	TNFSF11
Synonyms	CD254\|ODF\|OPGL\|OPTB2\|RANKL\|TNLG6B\|TRANCE\|hRANKL2\|sOdf
Description	tumor necrosis factor superfamily member 11
Reference	MIM:602642\|HGNC:HGNC:11926\|Ensembl:ENSG00000120659\|HPRD:04031\|Vega:OTTHUMG00000016807
Gene type	protein-coding
Map location	13q14
Pascal p-value	0.718
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0312

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg24534742	13	43149281	TNFSF11	2.266E-4	-0.233	0.036	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
DNAJB6	0.92	0.89
SUMO1	0.90	0.83
SSB	0.89	0.87
CBX3	0.88	0.85
DENR	0.88	0.84
DNTTIP2	0.88	0.84
FIP1L1	0.87	0.87
YWHAE	0.87	0.83
SNX4	0.87	0.81
RALA	0.87	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TREX1	-0.62	-0.73
HLA-F	-0.62	-0.70
FXYD1	-0.61	-0.70
TSC22D4	-0.60	-0.70
MT-CO2	-0.60	-0.68
AC018755.7	-0.60	-0.66
AF347015.33	-0.59	-0.68
IFI27	-0.59	-0.70
AF347015.9	-0.59	-0.72
AF347015.31	-0.58	-0.68

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
GO:0005125	cytokine activity	NAS		9568710
GO:0005164	tumor necrosis factor receptor binding	NAS		9312132 \|9367155
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006955	immune response	NAS		9312132
GO:0007275	multicellular organismal development	IEA		-
GO:0030154	cell differentiation	IEA		-
GO:0045780	positive regulation of bone resorption	IDA		17241109
GO:0045672	positive regulation of osteoclast differentiation	IDA		17241109
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	NAS		9568710 \|10708588
GO:0005615	extracellular space	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0005887	integral to plasma membrane	NAS		9312132

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	-	HPRD	10635328
KHDRBS1	FLJ34027 \| Sam68 \| p62	KH domain containing, RNA binding, signal transduction associated 1	Biochemical Activity	BioGRID	10635328
MAPK1	ERK \| ERK2 \| ERT1 \| MAPK2 \| P42MAPK \| PRKM1 \| PRKM2 \| p38 \| p40 \| p41 \| p41mapk	mitogen-activated protein kinase 1	-	HPRD	10635328
MAPK3	ERK1 \| HS44KDAP \| HUMKER1A \| MGC20180 \| P44ERK1 \| P44MAPK \| PRKM3	mitogen-activated protein kinase 3	-	HPRD	10635328
MAPK8	JNK \| JNK1 \| JNK1A2 \| JNK21B1/2 \| PRKM8 \| SAPK1	mitogen-activated protein kinase 8	-	HPRD	9396779
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	-	HPRD	10635328
NFKBIA	IKBA \| MAD-3 \| NFKBI	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	-	HPRD	10635328
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	Affinity Capture-Western	BioGRID	10635328
TNFRSF11A	CD265 \| FEO \| LOH18CR1 \| ODFR \| OFE \| OPTB7 \| OSTS \| PDB2 \| RANK \| TRANCER	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	-	HPRD	9367155
TNFRSF11B	MGC29565 \| OCIF \| OPG \| TR1	tumor necrosis factor receptor superfamily, member 11b	-	HPRD,BioGRID	9520411\|12221720
TRAF6	MGC:3310 \| RNF85	TNF receptor-associated factor 6	-	HPRD	10635328
ZNF675	FLJ36350 \| TBZF \| TIZ	zinc finger protein 675	Phenotypic Suppression	BioGRID	11751921

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION	267	161	All SZGR 2.0 genes in this pathway
BIOCARTA RANKL PATHWAY	14	13	All SZGR 2.0 genes in this pathway
PID IL6 7 PATHWAY	47	40	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA DN	349	157	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
BROWN MYELOID CELL DEVELOPMENT DN	129	86	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN	234	137	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
SAFFORD T LYMPHOCYTE ANERGY	87	54	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP	196	137	All SZGR 2.0 genes in this pathway
WORSCHECH TUMOR REJECTION UP	56	32	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME2 AND H3K27ME3	59	35	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS DN	54	38	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN	157	106	All SZGR 2.0 genes in this pathway
FUKUSHIMA TNFSF11 TARGETS	16	14	All SZGR 2.0 genes in this pathway
CARD MIR302A TARGETS	77	62	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 AND SATB1 DN	180	116	All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL MATURE UP	116	65	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS	344	197	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	801	807	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	801	807	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-17-5p/20/93.mr/106/519.d	617	623	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-181	1049	1055	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-194	398	404	1A	hsa-miR-194	UGUAACAGCAACUCCAUGUGGA
miR-410	463	469	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-410	463	469	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-493-5p	594	600	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-543	1050	1057	1A,m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TNFSF11