Summary ?
GeneID8633
SymbolUNC5C
SynonymsUNC5H3
Descriptionunc-5 netrin receptor C
ReferenceMIM:603610|HGNC:HGNC:12569|Ensembl:ENSG00000182168|HPRD:04678|Vega:OTTHUMG00000130989
Gene typeprotein-coding
Map location4q21-q23
Pascal p-value0.005
eGeneMeta

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
DEDD0.960.95
FTSJ10.940.95
TINF20.940.93
DHPS0.940.94
PRR30.940.94
DDOST0.940.93
ARMC60.940.95
RPUSD40.940.94
C4orf140.930.92
EIF4A10.930.93
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.27-0.78-0.90
AF347015.31-0.78-0.89
MT-CO2-0.78-0.89
AF347015.33-0.77-0.89
AF347015.8-0.77-0.91
MT-CYB-0.76-0.90
AF347015.15-0.74-0.89
AF347015.26-0.73-0.91
C5orf53-0.73-0.79
AIFM3-0.73-0.78

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005042netrin receptor activityTAS9782087 
GO:0004872receptor activityIEA-
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007420brain developmentTASBrain (GO term level: 7)9782087 
GO:0007411axon guidanceTASaxon (GO term level: 13)9126742 
GO:0007165signal transductionIEA-
GO:0006915apoptosisIEA-
GO:0007275multicellular organismal developmentIEA-
GO:0030334regulation of cell migrationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG AXON GUIDANCE 129103All SZGR 2.0 genes in this pathway
PID NETRIN PATHWAY 3227All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY 396292All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE 251188All SZGR 2.0 genes in this pathway
REACTOME NETRIN1 SIGNALING 4130All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291176All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142669All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP 414287All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS DN 14294All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP 250168All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721492All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549316All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR DN 244157All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 10HR UP 5438All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/3515956011Ahsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-30-5p3663731A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-324-5p3863931A,m8hsa-miR-324-5pCGCAUCCCCUAGGGCAUUGGUGU
miR-3393823891A,m8hsa-miR-339UCCCUGUCCUCCAGGAGCUCA
miR-3842943011A,m8hsa-miR-384AUUCCUAGAAAUUGUUCAUA
miR-4862742811A,m8hsa-miR-486UCCUGUACUGAGCUGCCCCGAG